ENPP2 cDNA ORF Clone, Human, C-HA tag

Cat: HG11308-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ENPP2 Reagents
CRO Services
Product recommended

All ENPP2 Reagents
ENPP2 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2592 bp
Description
Full length Clone DNA of Human ectonucleotide pyrophosphatase/phosphodiesterase 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ENPP2 cDNA ORF Clone, Human, C-HA tag Alternative Names
ATX cDNA ORF Clone, Human;ATX-X cDNA ORF Clone, Human;AUTOTAXIN cDNA ORF Clone, Human;LysoPLD cDNA ORF Clone, Human;NPP2 cDNA ORF Clone, Human;PD-IALPHA cDNA ORF Clone, Human;PDNP2 cDNA ORF Clone, Human
ENPP2 Background Information

ENPP2 (Ectonucleotide pyrophosphatase/phosphodiesterase family member 2), also referred as Autotaxin, is a secreted enzyme encoded by the ENPP2 gene. This gene product stimulates the motility of tumor cells, has angiogenic properties, and its expression is upregulated in several kinds of carcinomas. The Autotaxin protein is important for generating the lipid signaling molecule lysophosphatidic acid (LPA), which is a potent mitogen, which facilitates cell proliferation and migration, neurite retraction, platelet aggregation, smooth muscle contraction, actin stress formation and cytokine and chemokine secretion. ATX has been found to catalyze the formation of cyclic phosphatidic acid (cPA), which have antitumor role by antimitogenic regulation of cell cycle, inhibition of cancer invasion and metastasis. LPA receptors and ATX are upregulated in numerous cancer cell types and show expression patterns that correlate with tumor cell invasiveness. Thus, Autotaxin has recently emerged as an attractive target for the development of anti-cancer chemotherapeutics. In addition, Serum ATX activity was found to be enhanced in relation to hepatic fibrosis in chronic liver disease due to hepatitis virus C infection.

Full Name
ectonucleotide pyrophosphatase/phosphodiesterase 2
References
  • Tania M, et al. (2010) Autotaxin: a protein with two faces. Biochem Biophys Res Commun. 401(4): 493-7.
  • Ikeda H, et al. (2009) Significance of serum autotaxin activity in gastrointestinal disease. Rinsho Byori. 57(5): 445-9.
  • Parrill AL, et al. (2008) Autotaxin inhibition: challenges and progress toward novel anti-cancer agents. Anticancer Agents Med Chem. 8(8): 917-23.
  • Pradere J.P, et al. (2007) Secretion and lysophospholipase D activity of autotaxin by adipocytes are controlled by N-glycosylation and signal peptidase. Biochim Biophys Acta. 1771: 93-102.
  • Boucher J, et al. (2005) Potential involvement of adipocyte insulin resistance in obesity-associated up-regulation of adipocyte lysophospholipase D/autotaxin expression. Diabetologia. 48: 569-77.
  • ENPP2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    ENPP2 cDNA ORF Clone in Cloning Vector, Rhesus CG90223-G
    ENPP2 cDNA ORF Clone, Rhesus, untagged CG90223-UT
    ENPP2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90223-ACGLN
    ENPP2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90223-ACG
    ENPP2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90223-ACR
    ENPP2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90223-CF
    ENPP2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90223-NF
    ENPP2 cDNA ORF Clone, Rhesus, C-His tag CG90223-CH
    ENPP2 cDNA ORF Clone, Rhesus, N-His tag CG90223-NH
    ENPP2 cDNA ORF Clone, Rhesus, C-HA tag CG90223-CY
    ENPP2 cDNA ORF Clone, Rhesus, N-HA tag CG90223-NY
    ENPP2 cDNA ORF Clone, Rhesus, C-Myc tag CG90223-CM
    ENPP2 cDNA ORF Clone, Rhesus, N-Myc tag CG90223-NM

    ENPP2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ENPP2 cDNA ORF Clone in Cloning Vector, Mouse MG50663-G
    ENPP2 cDNA ORF Clone, Mouse, untagged MG50663-UT
    ENPP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50663-ACG
    ENPP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50663-ACGLN
    ENPP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50663-ACR
    ENPP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50663-CF
    ENPP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50663-NF
    ENPP2 cDNA ORF Clone, Mouse, C-His tag MG50663-CH
    ENPP2 cDNA ORF Clone, Mouse, N-His tag MG50663-NH
    ENPP2 cDNA ORF Clone, Mouse, C-HA tag MG50663-CY
    ENPP2 cDNA ORF Clone, Mouse, N-HA tag MG50663-NY
    ENPP2 cDNA ORF Clone, Mouse, C-Myc tag MG50663-CM
    ENPP2 cDNA ORF Clone, Mouse, N-Myc tag MG50663-NM
    ENPP2 qPCR Primer Pairs, Mouse MP200642

    ENPP2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ENPP2 cDNA ORF Clone in Cloning Vector, Human HG11308-M
    ENPP2 cDNA ORF Clone, Human, untagged HG11308-UT
    ENPP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11308-ACGLN
    ENPP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11308-ACG
    ENPP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11308-ACR
    ENPP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11308-CF
    ENPP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11308-NF
    ENPP2 cDNA ORF Clone, Human, C-His tag HG11308-CH
    ENPP2 cDNA ORF Clone, Human, N-His tag HG11308-NH
    ENPP2 cDNA ORF Clone, Human, N-HA tag HG11308-NY
    ENPP2 cDNA ORF Clone, Human, C-Myc tag HG11308-CM
    ENPP2 cDNA ORF Clone, Human, N-Myc tag HG11308-NM
    ENPP2 qPCR Primer Pairs, Human HP101196
    info info
    添加购物车成功! 添加购物车失败!