Quick Order

Human ENO2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ENO2 cDNA Clone Product Information
NCBI RefSeq:BC002745.2
RefSeq ORF Size:1305bp
cDNA Description:Full length Clone DNA of Homo sapiens enolase 2 (gamma, neuronal).
Gene Synonym:NSE
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Pechumer H, et al. (1994) Detection of neuron-specific gamma-enolase messenger ribonucleic acid in normal human leukocytes by polymerase chain reaction amplification with nested primers. Lab Invest. 69 (6): 743-9.
  • Craig SP, et al. (1991) Localisation of neurone-specific enolase (ENO2) to 12p13. Cytogenet Cell Genet. 54 (1-2): 71-3.
  • Muley T, et al. (2003) Technical performance and diagnostic utility of the new Elecsys neuron-specific enolase enzyme immunoassay. Clin Chem Lab Med. 41 (1): 95-103.
  • Size / Price
    Catalog: HG14573-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"