F4/80 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13756-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All F4/80 Reagents
CRO Services
Product recommended

All F4/80 Reagents
F4/80 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2466 bp
Description
Full length Clone DNA of Human egf-like module containing, mucin-like, hormone receptor-like 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

F4/80 cDNA ORF Clone, Human, N-Myc tag Alternative Names
F4/80 cDNA ORF Clone, Human

F4/80 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
F4/80 cDNA ORF Clone in Cloning Vector, Mouse MG57780-U
F4/80 cDNA ORF Clone, Mouse, untagged MG57780-UT
F4/80 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57780-ACG
F4/80 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57780-ACGLN
F4/80 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57780-ACR
F4/80 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57780-CF
F4/80 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57780-NF
F4/80 cDNA ORF Clone, Mouse, C-His tag MG57780-CH
F4/80 cDNA ORF Clone, Mouse, N-His tag MG57780-NH
F4/80 cDNA ORF Clone, Mouse, C-HA tag MG57780-CY
F4/80 cDNA ORF Clone, Mouse, N-HA tag MG57780-NY
F4/80 cDNA ORF Clone, Mouse, C-Myc tag MG57780-CM
F4/80 cDNA ORF Clone, Mouse, N-Myc tag MG57780-NM

F4/80 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
F4/80 cDNA ORF Clone in Cloning Vector, Human HG13756-G
F4/80 cDNA ORF Clone, Human, untagged HG13756-UT
F4/80 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13756-ACGLN
F4/80 cDNA ORF Clone, Human, C-GFPSpark® tag HG13756-ACG
F4/80 cDNA ORF Clone, Human, C-OFPSpark® tag HG13756-ACR
F4/80 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13756-CF
F4/80 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13756-NF
F4/80 cDNA ORF Clone, Human, C-His tag HG13756-CH
F4/80 cDNA ORF Clone, Human, N-His tag HG13756-NH
F4/80 cDNA ORF Clone, Human, C-HA tag HG13756-CY
F4/80 cDNA ORF Clone, Human, N-HA tag HG13756-NY
F4/80 cDNA ORF Clone, Human, C-Myc tag HG13756-CM
info info
添加购物车成功! 添加购物车失败!