EMG1 cDNA ORF Clone, Human, C-His tag

Cat: HG15296-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EMG1 Reagents
CRO Services
Product recommended

All EMG1 Reagents
EMG1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
735 bp
Description
Full length Clone DNA of Human EMG1 nucleolar protein homolog (S. cerevisiae) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EMG1 cDNA ORF Clone, Human, C-His tag Alternative Names
C2F cDNA ORF Clone, Human;Grcc2f cDNA ORF Clone, Human;NEP1 cDNA ORF Clone, Human
EMG1 Background Information
Full Name
EMG1 N1-specific pseudouridine methyltransferase

EMG1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EMG1 cDNA ORF Clone in Cloning Vector, Mouse MG52306-G
EMG1 cDNA ORF Clone, Mouse, untagged MG52306-UT
EMG1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52306-ACG
EMG1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52306-ACGLN
EMG1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52306-ANG
EMG1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52306-ACR
EMG1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52306-ANR
EMG1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52306-CF
EMG1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52306-NF
EMG1 cDNA ORF Clone, Mouse, C-His tag MG52306-CH
EMG1 cDNA ORF Clone, Mouse, N-His tag MG52306-NH
EMG1 cDNA ORF Clone, Mouse, C-HA tag MG52306-CY
EMG1 cDNA ORF Clone, Mouse, N-HA tag MG52306-NY
EMG1 cDNA ORF Clone, Mouse, C-Myc tag MG52306-CM
EMG1 cDNA ORF Clone, Mouse, N-Myc tag MG52306-NM
EMG1 qPCR Primer Pairs, Mouse MP202179

EMG1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EMG1 cDNA ORF Clone in Cloning Vector, Human HG15296-G
EMG1 cDNA ORF Clone, Human, untagged HG15296-UT
EMG1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15296-ACG
EMG1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15296-ACGLN
EMG1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15296-ANG
EMG1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15296-ACR
EMG1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15296-ANR
EMG1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15296-CF
EMG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15296-NF
EMG1 cDNA ORF Clone, Human, N-His tag HG15296-NH
EMG1 cDNA ORF Clone, Human, C-HA tag HG15296-CY
EMG1 cDNA ORF Clone, Human, N-HA tag HG15296-NY
EMG1 cDNA ORF Clone, Human, C-Myc tag HG15296-CM
EMG1 cDNA ORF Clone, Human, N-Myc tag HG15296-NM
EMG1 qPCR Primer Pairs, Human HP103922
info info
添加购物车成功! 添加购物车失败!