COX4NB cDNA ORF Clone, Human, C-HA tag

Cat: HG14675-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All COX4NB Reagents
CRO Services
Product recommended

All COX4NB Reagents
COX4NB cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
633 bp
Description
Full length Clone DNA of Human ER membrane protein complex subunit 8 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COX4NB cDNA ORF Clone, Human, C-HA tag Alternative Names
C16orf2 cDNA ORF Clone, Human;C16orf4 cDNA ORF Clone, Human;COX4NB cDNA ORF Clone, Human;FAM158B cDNA ORF Clone, Human;NOC4 cDNA ORF Clone, Human
COX4NB Background Information
Full Name
ER membrane protein complex subunit 8

COX4NB cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
COX4NB cDNA ORF Clone in Cloning Vector, Rat RG80825-G
COX4NB cDNA ORF Clone, Rat, untagged RG80825-UT
COX4NB cDNA ORF Clone, Rat, C-GFPSpark® tag RG80825-ACG
COX4NB Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80825-ACGLN
COX4NB cDNA ORF Clone, Rat, N-GFPSpark® tag RG80825-ANG
COX4NB cDNA ORF Clone, Rat, C-OFPSpark® tag RG80825-ACR
COX4NB cDNA ORF Clone, Rat, N-OFPSpark® tag RG80825-ANR
COX4NB cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80825-CF
COX4NB cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80825-NF
COX4NB cDNA ORF Clone, Rat, C-His tag RG80825-CH
COX4NB cDNA ORF Clone, Rat, N-His tag RG80825-NH
COX4NB cDNA ORF Clone, Rat, C-HA tag RG80825-CY
COX4NB cDNA ORF Clone, Rat, N-HA tag RG80825-NY
COX4NB cDNA ORF Clone, Rat, C-Myc tag RG80825-CM
COX4NB cDNA ORF Clone, Rat, N-Myc tag RG80825-NM
COX4NB qPCR Primer Pairs, Rat RP300789

COX4NB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COX4NB cDNA ORF Clone in Cloning Vector, Mouse MG53657-U
COX4NB cDNA ORF Clone, Mouse, untagged MG53657-UT
COX4NB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53657-ACG
COX4NB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53657-ACGLN
COX4NB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53657-ANG
COX4NB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53657-ACR
COX4NB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53657-ANR
COX4NB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53657-CF
COX4NB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53657-NF
COX4NB cDNA ORF Clone, Mouse, C-His tag MG53657-CH
COX4NB cDNA ORF Clone, Mouse, N-His tag MG53657-NH
COX4NB cDNA ORF Clone, Mouse, C-HA tag MG53657-CY
COX4NB cDNA ORF Clone, Mouse, N-HA tag MG53657-NY
COX4NB cDNA ORF Clone, Mouse, C-Myc tag MG53657-CM
COX4NB cDNA ORF Clone, Mouse, N-Myc tag MG53657-NM

COX4NB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COX4NB cDNA ORF Clone in Cloning Vector, Human HG14675-G
COX4NB cDNA ORF Clone, Human, untagged HG14675-UT
COX4NB cDNA ORF Clone, Human, C-GFPSpark® tag HG14675-ACG
COX4NB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14675-ACGLN
COX4NB cDNA ORF Clone, Human, N-GFPSpark® tag HG14675-ANG
COX4NB cDNA ORF Clone, Human, C-OFPSpark® tag HG14675-ACR
COX4NB cDNA ORF Clone, Human, N-OFPSpark® tag HG14675-ANR
COX4NB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14675-CF
COX4NB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14675-NF
COX4NB cDNA ORF Clone, Human, C-His tag HG14675-CH
COX4NB cDNA ORF Clone, Human, N-His tag HG14675-NH
COX4NB cDNA ORF Clone, Human, N-HA tag HG14675-NY
COX4NB cDNA ORF Clone, Human, C-Myc tag HG14675-CM
COX4NB cDNA ORF Clone, Human, N-Myc tag HG14675-NM
COX4NB qPCR Primer Pairs, Human HP103309
info info
添加购物车成功! 添加购物车失败!