ELOF1 cDNA ORF Clone, Human, N-HA tag

Cat: HG16474-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ELOF1 Reagents
CRO Services
Product recommended

All ELOF1 Reagents
ELOF1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
252 bp
Description
Full length Clone DNA of Human elongation factor 1 homolog (S. cerevisiae) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ELOF1 cDNA ORF Clone, Human, N-HA tag Alternative Names
ELF1 cDNA ORF Clone, Human
ELOF1 Background Information
Full Name
elongation factor 1 homolog (S. cerevisiae)

ELOF1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
ELOF1 cDNA ORF Clone in Cloning Vector, Rhesus CG90356-G
ELOF1 cDNA ORF Clone, Rhesus, untagged CG90356-UT
ELOF1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90356-ACGLN
ELOF1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90356-ACG
ELOF1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90356-ANG
ELOF1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90356-ACR
ELOF1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90356-ANR
ELOF1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90356-CF
ELOF1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90356-NF
ELOF1 cDNA ORF Clone, Rhesus, C-His tag CG90356-CH
ELOF1 cDNA ORF Clone, Rhesus, N-His tag CG90356-NH
ELOF1 cDNA ORF Clone, Rhesus, C-HA tag CG90356-CY
ELOF1 cDNA ORF Clone, Rhesus, N-HA tag CG90356-NY
ELOF1 cDNA ORF Clone, Rhesus, C-Myc tag CG90356-CM
ELOF1 cDNA ORF Clone, Rhesus, N-Myc tag CG90356-NM

ELOF1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ELOF1 cDNA ORF Clone in Cloning Vector, Rat RG81586-G

ELOF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ELOF1 cDNA ORF Clone in Cloning Vector, Mouse MG52587-U
ELOF1 cDNA ORF Clone, Mouse, untagged MG52587-UT
ELOF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52587-ACG
ELOF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52587-ACGLN
ELOF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52587-ANG
ELOF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52587-ACR
ELOF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52587-ANR
ELOF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52587-CF
ELOF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52587-NF
ELOF1 cDNA ORF Clone, Mouse, C-His tag MG52587-CH
ELOF1 cDNA ORF Clone, Mouse, N-His tag MG52587-NH
ELOF1 cDNA ORF Clone, Mouse, C-HA tag MG52587-CY
ELOF1 cDNA ORF Clone, Mouse, N-HA tag MG52587-NY
ELOF1 cDNA ORF Clone, Mouse, C-Myc tag MG52587-CM
ELOF1 cDNA ORF Clone, Mouse, N-Myc tag MG52587-NM
ELOF1 qPCR Primer Pairs, Mouse MP202458

ELOF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ELOF1 cDNA ORF Clone in Cloning Vector, Human HG16474-G
ELOF1 cDNA ORF Clone, Human, untagged HG16474-UT
ELOF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16474-ACGLN
ELOF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16474-ACG
ELOF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16474-ANG
ELOF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16474-ACR
ELOF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16474-ANR
ELOF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16474-CF
ELOF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16474-NF
ELOF1 cDNA ORF Clone, Human, C-His tag HG16474-CH
ELOF1 cDNA ORF Clone, Human, N-His tag HG16474-NH
ELOF1 cDNA ORF Clone, Human, C-HA tag HG16474-CY
ELOF1 cDNA ORF Clone, Human, C-Myc tag HG16474-CM
ELOF1 cDNA ORF Clone, Human, N-Myc tag HG16474-NM
ELOF1 qPCR Primer Pairs, Human HP105219
info info
添加购物车成功! 添加购物车失败!