EIF6 cDNA ORF Clone, Human, untagged

Cat: HG16195-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EIF6 Reagents
CRO Services
Product recommended

All EIF6 Reagents
EIF6 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
738 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 6.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF6 cDNA ORF Clone, Human, untagged Alternative Names
b(2)gcn cDNA ORF Clone, Human;CAB cDNA ORF Clone, Human;eIF-6 cDNA ORF Clone, Human;EIF3A cDNA ORF Clone, Human;ITGB4BP cDNA ORF Clone, Human;p27(BBP) cDNA ORF Clone, Human;p27BBP cDNA ORF Clone, Human
EIF6 Background Information
Full Name
eukaryotic translation initiation factor 6

EIF6 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
EIF6 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90408-G
EIF6 cDNA ORF Clone, Cynomolgus, untagged CG90408-UT
EIF6 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90408-ACGLN
EIF6 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90408-ACG
EIF6 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90408-ANG
EIF6 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90408-ACR
EIF6 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90408-ANR
EIF6 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90408-CF
EIF6 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90408-NF
EIF6 cDNA ORF Clone, Cynomolgus, C-His tag CG90408-CH
EIF6 cDNA ORF Clone, Cynomolgus, N-His tag CG90408-NH
EIF6 cDNA ORF Clone, Cynomolgus, C-HA tag CG90408-CY
EIF6 cDNA ORF Clone, Cynomolgus, N-HA tag CG90408-NY
EIF6 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90408-CM
EIF6 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90408-NM

EIF6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EIF6 cDNA ORF Clone in Cloning Vector, Rat RG8A4462-U
EIF6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A4462-ACGLN

EIF6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EIF6 cDNA ORF Clone in Cloning Vector, Mouse MG53164-G
EIF6 cDNA ORF Clone, Mouse, untagged MG53164-UT
EIF6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53164-ACG
EIF6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53164-ACGLN
EIF6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53164-ANG
EIF6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53164-ACR
EIF6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53164-ANR
EIF6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53164-CF
EIF6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53164-NF
EIF6 cDNA ORF Clone, Mouse, C-His tag MG53164-CH
EIF6 cDNA ORF Clone, Mouse, N-His tag MG53164-NH
EIF6 cDNA ORF Clone, Mouse, C-HA tag MG53164-CY
EIF6 cDNA ORF Clone, Mouse, N-HA tag MG53164-NY
EIF6 cDNA ORF Clone, Mouse, C-Myc tag MG53164-CM
EIF6 cDNA ORF Clone, Mouse, N-Myc tag MG53164-NM

EIF6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF6 cDNA ORF Clone in Cloning Vector, Human HG16195-G
EIF6 cDNA ORF Clone, Human, C-GFPSpark® tag HG16195-ACG
EIF6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16195-ACGLN
EIF6 cDNA ORF Clone, Human, N-GFPSpark® tag HG16195-ANG
EIF6 cDNA ORF Clone, Human, C-OFPSpark® tag HG16195-ACR
EIF6 cDNA ORF Clone, Human, N-OFPSpark® tag HG16195-ANR
EIF6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16195-CF
EIF6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16195-NF
EIF6 cDNA ORF Clone, Human, C-His tag HG16195-CH
EIF6 cDNA ORF Clone, Human, N-His tag HG16195-NH
EIF6 cDNA ORF Clone, Human, C-HA tag HG16195-CY
EIF6 cDNA ORF Clone, Human, N-HA tag HG16195-NY
EIF6 cDNA ORF Clone, Human, C-Myc tag HG16195-CM
EIF6 cDNA ORF Clone, Human, N-Myc tag HG16195-NM
EIF6 qPCR Primer Pairs, Human HP104963
info info
添加购物车成功! 添加购物车失败!