Text Size:AAA

Human EIF-5A/EIF5 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human EIF5 cDNA Clone Product Information
    NCBI RefSeq:BC007728
    RefSeq ORF Size:1296bp
    cDNA Description:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 5.
    Gene Synonym:EIF-5, EIF-5A
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EIF5 qPCR primers for gene expression analysis, HP102589 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    EIF-5A, also known as EIF5, functions in start site selection as a GTPase accelerating protein (GAP) for the eukaryotic translation initiation factor (eIF) 2•GTP•tRNA ternary complex within the ribosome-bound pre-initiation complex. In protein synthesis initiation, eIF2 functions in its GTP-bound state to deliver initiator methionyl-tRNA to the small ribosomal subunit and is necessary for protein synthesis in all cells. EIF-5A stabilizes the binding of GDP to eIF2 and is therefore a bi-functional protein that acts as a GDP dissociation inhibitor (GDI). EIF-5A also interacts with eIF1 and eIF3 and binds the eIF2-GTP/Met-tRNA ternary complex along with the 40S ribosome subunit.

    References
  • Si K, et al. (1996) Charactatierizon of multiple mRNAs that encode mammalian translation initiation factor 5 (eIF-5). J Biol Chem. 71(28):16934.
  • Das S, et al. (1998) Specific interaction of eukaryotic translation initiation factor 5 (eIF5) with the beta-subunit of eIF2. J Biol Chem. 272(50):31712-8.
  • Conte MR, et al. (2006) Structure of the eukaryotic initiation factor (eIF) 5 reveals a fold common to several translation factors. Biochemistry. 45(14):4550-8.
  • Size / Price
    Catalog: HG13932-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"