EIF4H cDNA ORF Clone, Human, C-HA tag

Cat: HG14633-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EIF4H Reagents
CRO Services
Product recommended

All EIF4H Reagents
EIF4H cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
687 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 4H with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF4H cDNA ORF Clone, Human, C-HA tag Alternative Names
eIF-4H cDNA ORF Clone, Human;WBSCR1 cDNA ORF Clone, Human;WSCR1 cDNA ORF Clone, Human
EIF4H Background Information
Full Name
eukaryotic translation initiation factor 4H

EIF4H cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EIF4H cDNA ORF Clone in Cloning Vector, Mouse MG51632-G
EIF4H cDNA ORF Clone, Mouse, untagged MG51632-UT
EIF4H Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51632-ACGLN
EIF4H cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51632-ACG
EIF4H cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51632-ANG
EIF4H cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51632-ACR
EIF4H cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51632-ANR
EIF4H cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51632-CF
EIF4H cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51632-NF
EIF4H cDNA ORF Clone, Mouse, C-His tag MG51632-CH
EIF4H cDNA ORF Clone, Mouse, N-His tag MG51632-NH
EIF4H cDNA ORF Clone, Mouse, C-HA tag MG51632-CY
EIF4H cDNA ORF Clone, Mouse, N-HA tag MG51632-NY
EIF4H cDNA ORF Clone, Mouse, C-Myc tag MG51632-CM
EIF4H cDNA ORF Clone, Mouse, N-Myc tag MG51632-NM
EIF4H qPCR Primer Pairs, Mouse MP201505

EIF4H cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF4H cDNA ORF Clone in Cloning Vector, Human HG14633-G
EIF4H cDNA ORF Clone, Human, untagged HG14633-UT
EIF4H Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14633-ACGLN
EIF4H cDNA ORF Clone, Human, C-GFPSpark® tag HG14633-ACG
EIF4H cDNA ORF Clone, Human, N-GFPSpark® tag HG14633-ANG
EIF4H cDNA ORF Clone, Human, C-OFPSpark® tag HG14633-ACR
EIF4H cDNA ORF Clone, Human, N-OFPSpark® tag HG14633-ANR
EIF4H cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14633-CF
EIF4H cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14633-NF
EIF4H cDNA ORF Clone, Human, C-His tag HG14633-CH
EIF4H cDNA ORF Clone, Human, N-His tag HG14633-NH
EIF4H cDNA ORF Clone, Human, N-HA tag HG14633-NY
EIF4H cDNA ORF Clone, Human, C-Myc tag HG14633-CM
EIF4H cDNA ORF Clone, Human, N-Myc tag HG14633-NM
EIF4H qPCR Primer Pairs, Human HP103267
info info
添加购物车成功! 添加购物车失败!