EIF4EL3/EIF4E2 cDNA ORF Clone, Human, N-HA tag

Cat: HG14646-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EIF4EL3/EIF4E2 Reagents
CRO Services
Product recommended

All EIF4EL3/EIF4E2 Reagents
EIF4EL3/EIF4E2 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
738 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 4E family member 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF4EL3/EIF4E2 cDNA ORF Clone, Human, N-HA tag Alternative Names
4E-LP cDNA ORF Clone, Human;4EHP cDNA ORF Clone, Human;EIF4EL3 cDNA ORF Clone, Human;IF4e cDNA ORF Clone, Human
EIF4EL3/EIF4E2 Background Information
Full Name
eukaryotic translation initiation factor 4E family member 2

EIF4EL3/EIF4E2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EIF4EL3/EIF4E2 cDNA ORF Clone in Cloning Vector, Mouse MG5A2963-U
EIF4EL3/EIF4E2 cDNA ORF Clone, Mouse, untagged MG5A2963-UT
EIF4EL3/EIF4E2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2963-ACGLN
EIF4EL3/EIF4E2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2963-ACG
EIF4EL3/EIF4E2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2963-ANG
EIF4EL3/EIF4E2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2963-ACR
EIF4EL3/EIF4E2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2963-ANR
EIF4EL3/EIF4E2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2963-CF
EIF4EL3/EIF4E2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2963-NF
EIF4EL3/EIF4E2 cDNA ORF Clone, Mouse, C-His tag MG5A2963-CH
EIF4EL3/EIF4E2 cDNA ORF Clone, Mouse, N-His tag MG5A2963-NH
EIF4EL3/EIF4E2 cDNA ORF Clone, Mouse, C-HA tag MG5A2963-CY
EIF4EL3/EIF4E2 cDNA ORF Clone, Mouse, N-HA tag MG5A2963-NY
EIF4EL3/EIF4E2 cDNA ORF Clone, Mouse, C-Myc tag MG5A2963-CM
EIF4EL3/EIF4E2 cDNA ORF Clone, Mouse, N-Myc tag MG5A2963-NM

EIF4EL3/EIF4E2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF4EL3/EIF4E2 cDNA ORF Clone in Cloning Vector, Human HG14646-G
EIF4EL3/EIF4E2 cDNA ORF Clone, Human, untagged HG14646-UT
EIF4EL3/EIF4E2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14646-ACG
EIF4EL3/EIF4E2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14646-ACGLN
EIF4EL3/EIF4E2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14646-ANG
EIF4EL3/EIF4E2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14646-ACR
EIF4EL3/EIF4E2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14646-ANR
EIF4EL3/EIF4E2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14646-CF
EIF4EL3/EIF4E2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14646-NF
EIF4EL3/EIF4E2 cDNA ORF Clone, Human, C-His tag HG14646-CH
EIF4EL3/EIF4E2 cDNA ORF Clone, Human, N-His tag HG14646-NH
EIF4EL3/EIF4E2 cDNA ORF Clone, Human, C-HA tag HG14646-CY
EIF4EL3/EIF4E2 cDNA ORF Clone, Human, C-Myc tag HG14646-CM
EIF4EL3/EIF4E2 cDNA ORF Clone, Human, N-Myc tag HG14646-NM
EIF4EL3/EIF4E2 qPCR Primer Pairs, Human HP103280
info info
添加购物车成功! 添加购物车失败!