PCID1 cDNA ORF Clone, Human, untagged

Cat: HG15536-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PCID1 Reagents
CRO Services
Product recommended

All PCID1 Reagents
PCID1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1125 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 3, subunit M.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PCID1 cDNA ORF Clone, Human, untagged Alternative Names
B5 cDNA ORF Clone, Human;GA17 cDNA ORF Clone, Human;hfl-B5 cDNA ORF Clone, Human;PCID1 cDNA ORF Clone, Human;TANGO7 cDNA ORF Clone, Human
PCID1 Background Information
Full Name
eukaryotic translation initiation factor 3, subunit M

PCID1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PCID1 cDNA ORF Clone in Cloning Vector, Rat RG81244-U
PCID1 cDNA ORF Clone, Rat, untagged RG81244-UT
PCID1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81244-ACGLN
PCID1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81244-ACG
PCID1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81244-ANG
PCID1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81244-ACR
PCID1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81244-ANR
PCID1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81244-CF
PCID1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81244-NF
PCID1 cDNA ORF Clone, Rat, C-His tag RG81244-CH
PCID1 cDNA ORF Clone, Rat, N-His tag RG81244-NH
PCID1 cDNA ORF Clone, Rat, C-HA tag RG81244-CY
PCID1 cDNA ORF Clone, Rat, N-HA tag RG81244-NY
PCID1 cDNA ORF Clone, Rat, C-Myc tag RG81244-CM
PCID1 cDNA ORF Clone, Rat, N-Myc tag RG81244-NM
PCID1 qPCR Primer Pairs, Rat RP301200

PCID1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PCID1 cDNA ORF Clone in Cloning Vector, Human HG15536-G
PCID1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15536-ACG
PCID1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15536-ACGLN
PCID1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15536-ANG
PCID1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15536-ACR
PCID1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15536-ANR
PCID1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15536-CF
PCID1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15536-NF
PCID1 cDNA ORF Clone, Human, C-His tag HG15536-CH
PCID1 cDNA ORF Clone, Human, N-His tag HG15536-NH
PCID1 cDNA ORF Clone, Human, C-HA tag HG15536-CY
PCID1 cDNA ORF Clone, Human, N-HA tag HG15536-NY
PCID1 cDNA ORF Clone, Human, C-Myc tag HG15536-CM
PCID1 cDNA ORF Clone, Human, N-Myc tag HG15536-NM
PCID1 qPCR Primer Pairs, Human HP104157
info info
添加购物车成功! 添加购物车失败!