EIF2B1 cDNA ORF Clone, Human, C-His tag

Cat: HG15825-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EIF2B1 Reagents
CRO Services
Product recommended

All EIF2B1 Reagents
EIF2B1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
918 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF2B1 cDNA ORF Clone, Human, C-His tag Alternative Names
EIF2B cDNA ORF Clone, Human;EIF2BA cDNA ORF Clone, Human
EIF2B1 Background Information
Full Name
eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa

EIF2B1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EIF2B1 cDNA ORF Clone in Cloning Vector, Mouse MG51640-G
EIF2B1 cDNA ORF Clone, Mouse, untagged MG51640-UT
EIF2B1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51640-ACGLN
EIF2B1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51640-ACG
EIF2B1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51640-ANG
EIF2B1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51640-ACR
EIF2B1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51640-ANR
EIF2B1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51640-CF
EIF2B1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51640-NF
EIF2B1 cDNA ORF Clone, Mouse, C-His tag MG51640-CH
EIF2B1 cDNA ORF Clone, Mouse, N-His tag MG51640-NH
EIF2B1 cDNA ORF Clone, Mouse, C-HA tag MG51640-CY
EIF2B1 cDNA ORF Clone, Mouse, N-HA tag MG51640-NY
EIF2B1 cDNA ORF Clone, Mouse, C-Myc tag MG51640-CM
EIF2B1 cDNA ORF Clone, Mouse, N-Myc tag MG51640-NM
EIF2B1 qPCR Primer Pairs, Mouse MP201513

EIF2B1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF2B1 cDNA ORF Clone in Cloning Vector, Human HG15825-G
EIF2B1 cDNA ORF Clone, Human, untagged HG15825-UT
EIF2B1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15825-ACG
EIF2B1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15825-ACGLN
EIF2B1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15825-ANG
EIF2B1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15825-ACR
EIF2B1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15825-ANR
EIF2B1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15825-CF
EIF2B1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15825-NF
EIF2B1 cDNA ORF Clone, Human, N-His tag HG15825-NH
EIF2B1 cDNA ORF Clone, Human, C-HA tag HG15825-CY
EIF2B1 cDNA ORF Clone, Human, N-HA tag HG15825-NY
EIF2B1 cDNA ORF Clone, Human, C-Myc tag HG15825-CM
EIF2B1 cDNA ORF Clone, Human, N-Myc tag HG15825-NM
EIF2B1 qPCR Primer Pairs, Human HP104416
info info
添加购物车成功! 添加购物车失败!