eIF2AK1/HRI cDNA ORF Clone, Human, untagged

Cat: HG10663-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All eIF2AK1/HRI Reagents

CRO Services

Product recommended


All eIF2AK1/HRI Reagents

eIF2AK1/HRI cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1893 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 2-alpha kinase 1.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

eIF2AK1/HRI Background Information

Full Name
eukaryotic translation initiation factor 2 alpha kinase 1

eIF2AK1/HRI cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
eIF2AK1/HRI cDNA ORF Clone in Cloning Vector, Rat RG85815-U
eIF2AK1/HRI Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85815-ACGLN

eIF2AK1/HRI cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
eIF2AK1/HRI cDNA ORF Clone in Cloning Vector, Mouse MG50852-G
eIF2AK1/HRI cDNA ORF Clone, Mouse, untagged MG50852-UT
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50852-ACG
eIF2AK1/HRI Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50852-ACGLN
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50852-ANG
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50852-ACR
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50852-ANR
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50852-CF
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50852-NF
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-His tag MG50852-CH
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-His tag MG50852-NH
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-HA tag MG50852-CY
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-HA tag MG50852-NY
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-Myc tag MG50852-CM
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-Myc tag MG50852-NM
eIF2AK1/HRI qPCR Primer Pairs, Mouse MP200823

eIF2AK1/HRI cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
eIF2AK1/HRI cDNA ORF Clone in Cloning Vector, Human HG10663-M
eIF2AK1/HRI cDNA ORF Clone, Human, C-GFPSpark® tag HG10663-ACG
eIF2AK1/HRI Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10663-ACGLN
eIF2AK1/HRI cDNA ORF Clone, Human, N-GFPSpark® tag HG10663-ANG
eIF2AK1/HRI cDNA ORF Clone, Human, C-OFPSpark® tag HG10663-ACR
eIF2AK1/HRI cDNA ORF Clone, Human, N-OFPSpark® tag HG10663-ANR
eIF2AK1/HRI cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10663-CF
eIF2AK1/HRI cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10663-NF
eIF2AK1/HRI cDNA ORF Clone, Human, C-His tag HG10663-CH
eIF2AK1/HRI cDNA ORF Clone, Human, N-His tag HG10663-NH
eIF2AK1/HRI cDNA ORF Clone, Human, C-HA tag HG10663-CY
eIF2AK1/HRI cDNA ORF Clone, Human, N-HA tag HG10663-NY
eIF2AK1/HRI cDNA ORF Clone, Human, C-Myc tag HG10663-CM
eIF2AK1/HRI cDNA ORF Clone, Human, N-Myc tag HG10663-NM
eIF2AK1/HRI qPCR Primer Pairs, Human HP100631
info info
添加购物车成功! 添加购物车失败!