eIF2AK1/HRI cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10663-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All eIF2AK1/HRI Reagents
CRO Services
Product recommended

All eIF2AK1/HRI Reagents
eIF2AK1/HRI cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1893 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 2-alpha kinase 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

eIF2AK1/HRI cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human eIF2AK1/HRI Gene Expression validated Image 16551
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
eIF2AK1/HRI Background Information
Full Name
eukaryotic translation initiation factor 2 alpha kinase 1

eIF2AK1/HRI cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
eIF2AK1/HRI cDNA ORF Clone in Cloning Vector, Rat RG85815-U
eIF2AK1/HRI Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85815-ACGLN

eIF2AK1/HRI cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
eIF2AK1/HRI cDNA ORF Clone in Cloning Vector, Mouse MG50852-G
eIF2AK1/HRI cDNA ORF Clone, Mouse, untagged MG50852-UT
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50852-ACG
eIF2AK1/HRI Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50852-ACGLN
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50852-ANG
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50852-ACR
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50852-ANR
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50852-CF
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50852-NF
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-His tag MG50852-CH
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-His tag MG50852-NH
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-HA tag MG50852-CY
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-HA tag MG50852-NY
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-Myc tag MG50852-CM
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-Myc tag MG50852-NM
eIF2AK1/HRI qPCR Primer Pairs, Mouse MP200823

eIF2AK1/HRI cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
eIF2AK1/HRI cDNA ORF Clone in Cloning Vector, Human HG10663-M
eIF2AK1/HRI cDNA ORF Clone, Human, untagged HG10663-UT
eIF2AK1/HRI Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10663-ACGLN
eIF2AK1/HRI cDNA ORF Clone, Human, C-GFPSpark® tag HG10663-ACG
eIF2AK1/HRI cDNA ORF Clone, Human, N-GFPSpark® tag HG10663-ANG
eIF2AK1/HRI cDNA ORF Clone, Human, C-OFPSpark® tag HG10663-ACR
eIF2AK1/HRI cDNA ORF Clone, Human, N-OFPSpark® tag HG10663-ANR
eIF2AK1/HRI cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10663-CF
eIF2AK1/HRI cDNA ORF Clone, Human, C-His tag HG10663-CH
eIF2AK1/HRI cDNA ORF Clone, Human, N-His tag HG10663-NH
eIF2AK1/HRI cDNA ORF Clone, Human, C-HA tag HG10663-CY
eIF2AK1/HRI cDNA ORF Clone, Human, N-HA tag HG10663-NY
eIF2AK1/HRI cDNA ORF Clone, Human, C-Myc tag HG10663-CM
eIF2AK1/HRI cDNA ORF Clone, Human, N-Myc tag HG10663-NM
eIF2AK1/HRI qPCR Primer Pairs, Human HP100631
info info
添加购物车成功! 添加购物车失败!