eIF2AK1/HRI cDNA ORF Clone, Human, C-Myc tag

Cat: HG10663-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All eIF2AK1/HRI Reagents
CRO Services
Product recommended

All eIF2AK1/HRI Reagents
eIF2AK1/HRI cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1893 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 2-alpha kinase 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

eIF2AK1/HRI Background Information
Full Name
eukaryotic translation initiation factor 2 alpha kinase 1

eIF2AK1/HRI cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
eIF2AK1/HRI cDNA ORF Clone in Cloning Vector, Rat RG85815-U
eIF2AK1/HRI Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85815-ACGLN

eIF2AK1/HRI cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
eIF2AK1/HRI cDNA ORF Clone in Cloning Vector, Mouse MG50852-G
eIF2AK1/HRI cDNA ORF Clone, Mouse, untagged MG50852-UT
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50852-ACG
eIF2AK1/HRI Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50852-ACGLN
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50852-ANG
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50852-ACR
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50852-ANR
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50852-CF
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50852-NF
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-His tag MG50852-CH
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-His tag MG50852-NH
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-HA tag MG50852-CY
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-HA tag MG50852-NY
eIF2AK1/HRI cDNA ORF Clone, Mouse, C-Myc tag MG50852-CM
eIF2AK1/HRI cDNA ORF Clone, Mouse, N-Myc tag MG50852-NM
eIF2AK1/HRI qPCR Primer Pairs, Mouse MP200823

eIF2AK1/HRI cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
eIF2AK1/HRI cDNA ORF Clone in Cloning Vector, Human HG10663-M
eIF2AK1/HRI cDNA ORF Clone, Human, untagged HG10663-UT
eIF2AK1/HRI Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10663-ACGLN
eIF2AK1/HRI cDNA ORF Clone, Human, C-GFPSpark® tag HG10663-ACG
eIF2AK1/HRI cDNA ORF Clone, Human, N-GFPSpark® tag HG10663-ANG
eIF2AK1/HRI cDNA ORF Clone, Human, C-OFPSpark® tag HG10663-ACR
eIF2AK1/HRI cDNA ORF Clone, Human, N-OFPSpark® tag HG10663-ANR
eIF2AK1/HRI cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10663-CF
eIF2AK1/HRI cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10663-NF
eIF2AK1/HRI cDNA ORF Clone, Human, C-His tag HG10663-CH
eIF2AK1/HRI cDNA ORF Clone, Human, N-His tag HG10663-NH
eIF2AK1/HRI cDNA ORF Clone, Human, C-HA tag HG10663-CY
eIF2AK1/HRI cDNA ORF Clone, Human, N-HA tag HG10663-NY
eIF2AK1/HRI cDNA ORF Clone, Human, N-Myc tag HG10663-NM
eIF2AK1/HRI qPCR Primer Pairs, Human HP100631
info info
添加购物车成功! 添加购物车失败!