EIF1AX cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG14516-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EIF1AX Reagents
CRO Services
Product recommended

All EIF1AX Reagents
EIF1AX cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
474 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 1A, X-linked with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.47kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
EIF1AX cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF1AX cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
EIF1AX cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
eIF-1A cDNA ORF Clone, Human;eIF-4C cDNA ORF Clone, Human;EIF1A cDNA ORF Clone, Human;EIF1AP1 cDNA ORF Clone, Human;EIF4C cDNA ORF Clone, Human
EIF1AX Background Information
Full Name
eukaryotic translation initiation factor 1A, X-linked

EIF1AX cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
EIF1AX cDNA ORF Clone in Cloning Vector, Rhesus CG90658-G
EIF1AX cDNA ORF Clone, Rhesus, untagged CG90658-UT
EIF1AX cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90658-ACG
EIF1AX Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90658-ACGLN
EIF1AX cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90658-ANG
EIF1AX cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90658-ACR
EIF1AX cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90658-ANR
EIF1AX cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90658-CF
EIF1AX cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90658-NF
EIF1AX cDNA ORF Clone, Rhesus, C-His tag CG90658-CH
EIF1AX cDNA ORF Clone, Rhesus, N-His tag CG90658-NH
EIF1AX cDNA ORF Clone, Rhesus, C-HA tag CG90658-CY
EIF1AX cDNA ORF Clone, Rhesus, N-HA tag CG90658-NY
EIF1AX cDNA ORF Clone, Rhesus, C-Myc tag CG90658-CM
EIF1AX cDNA ORF Clone, Rhesus, N-Myc tag CG90658-NM

EIF1AX cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EIF1AX cDNA ORF Clone in Cloning Vector, Rat RG80833-U
EIF1AX cDNA ORF Clone, Rat, untagged RG80833-UT
EIF1AX Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80833-ACGLN
EIF1AX cDNA ORF Clone, Rat, C-GFPSpark® tag RG80833-ACG
EIF1AX cDNA ORF Clone, Rat, N-GFPSpark® tag RG80833-ANG
EIF1AX cDNA ORF Clone, Rat, C-OFPSpark® tag RG80833-ACR
EIF1AX cDNA ORF Clone, Rat, N-OFPSpark® tag RG80833-ANR
EIF1AX cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80833-CF
EIF1AX cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80833-NF
EIF1AX cDNA ORF Clone, Rat, C-His tag RG80833-CH
EIF1AX cDNA ORF Clone, Rat, N-His tag RG80833-NH
EIF1AX cDNA ORF Clone, Rat, C-HA tag RG80833-CY
EIF1AX cDNA ORF Clone, Rat, N-HA tag RG80833-NY
EIF1AX cDNA ORF Clone, Rat, C-Myc tag RG80833-CM
EIF1AX cDNA ORF Clone, Rat, N-Myc tag RG80833-NM
EIF1AX qPCR Primer Pairs, Rat RP300797

EIF1AX cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EIF1AX cDNA ORF Clone in Cloning Vector, Mouse MG5A5266-U
EIF1AX cDNA ORF Clone, Mouse, untagged MG5A5266-UT
EIF1AX cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5266-ACG
EIF1AX Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5266-ACGLN
EIF1AX cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5266-ANG
EIF1AX cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5266-ACR
EIF1AX cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5266-ANR
EIF1AX cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5266-CF
EIF1AX cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5266-NF
EIF1AX cDNA ORF Clone, Mouse, C-His tag MG5A5266-CH
EIF1AX cDNA ORF Clone, Mouse, N-His tag MG5A5266-NH
EIF1AX cDNA ORF Clone, Mouse, C-HA tag MG5A5266-CY
EIF1AX cDNA ORF Clone, Mouse, N-HA tag MG5A5266-NY
EIF1AX cDNA ORF Clone, Mouse, C-Myc tag MG5A5266-CM
EIF1AX cDNA ORF Clone, Mouse, N-Myc tag MG5A5266-NM

EIF1AX cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF1AX cDNA ORF Clone in Cloning Vector, Human HG14516-G
EIF1AX cDNA ORF Clone, Human, untagged HG14516-UT
EIF1AX cDNA ORF Clone, Human, C-GFPSpark® tag HG14516-ACG
EIF1AX Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14516-ACGLN
EIF1AX cDNA ORF Clone, Human, N-GFPSpark® tag HG14516-ANG
EIF1AX cDNA ORF Clone, Human, C-OFPSpark® tag HG14516-ACR
EIF1AX cDNA ORF Clone, Human, N-OFPSpark® tag HG14516-ANR
EIF1AX cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14516-NF
EIF1AX cDNA ORF Clone, Human, C-His tag HG14516-CH
EIF1AX cDNA ORF Clone, Human, N-His tag HG14516-NH
EIF1AX cDNA ORF Clone, Human, C-HA tag HG14516-CY
EIF1AX cDNA ORF Clone, Human, N-HA tag HG14516-NY
EIF1AX cDNA ORF Clone, Human, C-Myc tag HG14516-CM
EIF1AX cDNA ORF Clone, Human, N-Myc tag HG14516-NM
EIF1AX qPCR Primer Pairs, Human HP103163
info info
添加购物车成功! 添加购物车失败!