EIF1AD cDNA ORF Clone, Human, N-Myc tag

Cat: HG14930-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EIF1AD Reagents
CRO Services
Product recommended

All EIF1AD Reagents
EIF1AD cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
498 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 1A domain containing with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF1AD cDNA ORF Clone, Human, N-Myc tag Alternative Names
haponin cDNA ORF Clone, Human
EIF1AD Background Information
Full Name
eukaryotic translation initiation factor 1A domain containing

EIF1AD cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EIF1AD cDNA ORF Clone in Cloning Vector, Mouse MG54705-U
EIF1AD cDNA ORF Clone, Mouse, untagged MG54705-UT
EIF1AD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54705-ACGLN
EIF1AD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54705-ACG
EIF1AD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG54705-ANG
EIF1AD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG54705-ACR
EIF1AD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG54705-ANR
EIF1AD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG54705-CF
EIF1AD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG54705-NF
EIF1AD cDNA ORF Clone, Mouse, C-His tag MG54705-CH
EIF1AD cDNA ORF Clone, Mouse, N-His tag MG54705-NH
EIF1AD cDNA ORF Clone, Mouse, C-HA tag MG54705-CY
EIF1AD cDNA ORF Clone, Mouse, N-HA tag MG54705-NY
EIF1AD cDNA ORF Clone, Mouse, C-Myc tag MG54705-CM
EIF1AD cDNA ORF Clone, Mouse, N-Myc tag MG54705-NM

EIF1AD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF1AD cDNA ORF Clone in Cloning Vector, Human HG14930-G
EIF1AD cDNA ORF Clone, Human, untagged HG14930-UT
EIF1AD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14930-ACGLN
EIF1AD cDNA ORF Clone, Human, C-GFPSpark® tag HG14930-ACG
EIF1AD cDNA ORF Clone, Human, N-GFPSpark® tag HG14930-ANG
EIF1AD cDNA ORF Clone, Human, C-OFPSpark® tag HG14930-ACR
EIF1AD cDNA ORF Clone, Human, N-OFPSpark® tag HG14930-ANR
EIF1AD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14930-CF
EIF1AD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14930-NF
EIF1AD cDNA ORF Clone, Human, C-His tag HG14930-CH
EIF1AD cDNA ORF Clone, Human, N-His tag HG14930-NH
EIF1AD cDNA ORF Clone, Human, C-HA tag HG14930-CY
EIF1AD cDNA ORF Clone, Human, N-HA tag HG14930-NY
EIF1AD cDNA ORF Clone, Human, C-Myc tag HG14930-CM
EIF1AD qPCR Primer Pairs, Human HP103559
info info
添加购物车成功! 添加购物车失败!