EGR2 cDNA ORF Clone, Human, N-His tag

Cat: HG14868-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EGR2 Reagents
CRO Services
Product recommended

All EGR2 Reagents
EGR2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1545 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human early growth response 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Restriction Sites
HindIII + NotI(6kb+1.55kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
EGR2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EGR2 cDNA ORF Clone, Human, N-His tag Validated Images
Human DHCR7 Gene Plasmid Map 5861
EGR2 cDNA ORF Clone, Human, N-His tag Alternative Names
AT591 cDNA ORF Clone, Human;CMT1D cDNA ORF Clone, Human;CMT4E cDNA ORF Clone, Human;KROX20 cDNA ORF Clone, Human
EGR2 Background Information
Full Name
early growth response 2

EGR2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EGR2 cDNA ORF Clone in Cloning Vector, Mouse MG57074-U
EGR2 cDNA ORF Clone, Mouse, untagged MG57074-UT
EGR2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57074-ACG
EGR2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57074-ACGLN
EGR2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57074-ANG
EGR2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57074-ACR
EGR2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57074-ANR
EGR2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57074-CF
EGR2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57074-NF
EGR2 cDNA ORF Clone, Mouse, C-His tag MG57074-CH
EGR2 cDNA ORF Clone, Mouse, N-His tag MG57074-NH
EGR2 cDNA ORF Clone, Mouse, C-HA tag MG57074-CY
EGR2 cDNA ORF Clone, Mouse, N-HA tag MG57074-NY
EGR2 cDNA ORF Clone, Mouse, C-Myc tag MG57074-CM
EGR2 cDNA ORF Clone, Mouse, N-Myc tag MG57074-NM

EGR2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EGR2 cDNA ORF Clone in Cloning Vector, Human HG14868-G
EGR2 cDNA ORF Clone, Human, untagged HG14868-UT
EGR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14868-ACG
EGR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14868-ACGLN
EGR2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14868-ANG
EGR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14868-ACR
EGR2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14868-ANR
EGR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14868-CF
EGR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14868-NF
EGR2 cDNA ORF Clone, Human, C-His tag HG14868-CH
EGR2 cDNA ORF Clone, Human, C-HA tag HG14868-CY
EGR2 cDNA ORF Clone, Human, N-HA tag HG14868-NY
EGR2 cDNA ORF Clone, Human, C-Myc tag HG14868-CM
EGR2 cDNA ORF Clone, Human, N-Myc tag HG14868-NM
EGR2 qPCR Primer Pairs, Human HP103499
info info
添加购物车成功! 添加购物车失败!