Quick Order

Human EGFR/HER1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human EGFR cDNA Clone Product Information
NCBI RefSeq:NM_005228.3
RefSeq ORF Size:3633bp
cDNA Description:Full length Clone DNA of Homo sapiens epidermal growth factor receptor.
Gene Synonym:EGFR, ERBB, HER1, mENA, ERBB1, PIG61
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-EGFR
Restriction Site:KpnI + XbaI (6.1kb + 3.63kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 2361 G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with EGFR qPCR primers for gene expression analysis, HP100094 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human EGFR Gene Plasmid Map
Human EGFR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type I transmembrane glycoprotein that binds a subset of EGF family ligands including EGF, amphiregulin, TGF-α, betacellulin, etc. EGFR protein plays a crucial role in signaling pathway in the regulation of cell proliferation, survival and differentiation. Binding of a ligand induces EGFR protein homo- or heterodimerization, the subsequent tyrosine autophosphorylation and initiates various down stream pathways (MAPK, PI3K/PKB and STAT). In addition, EGFR signaling also has been shown to exert action on carcinogenesis and disease progression, and thus EGFR protein is proposed as a target for cancer therapy currently.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Schlessinger, J. (2000) Cell signaling by receptor tyrosine kinases. Cell 103(2): 211-25.
  • Giaccone, G. (2005) HER1/EGFR-targeted agents: predicting the future for patients with unpredictable outcomes to therapy. Ann. Oncol. 16(4): 538-48.
  • Yarden, Y., et al. (2001) Untangling the ErbB signalling network. Nat. Rev. Mol. Cell. Biol. 2(2): 127-37.
  • Size / Price
    Catalog: HG10001-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry
    Contact Us
    Images
    • Human EGFR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"