EED cDNA ORF Clone, Human, untagged

Cat: HG11307-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EED Reagents
CRO Services
Product recommended

All EED Reagents
EED cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1326 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 619 C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human embryonic ectoderm development.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + NotI (6.1kb + 1.33kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
EED cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EED cDNA ORF Clone, Human, untagged Validated Images
Human IL12A / IL-12A Gene Plasmid Map 5647
EED cDNA ORF Clone, Human, untagged Alternative Names
HEED cDNA ORF Clone, Human;WAIT1 cDNA ORF Clone, Human
EED Background Information
Full Name
embryonic ectoderm development
References
  • Ura H, et al. (2011) Eed/Sox2 regulatory loop controls ES cell self-renewal through histone methylation and acetylation. EMBO J. 30(11): 2190-204.
  • Montgomery ND, et al. (2007) Molecular and functional mapping of EED motifs required for PRC2-dependent histone methylation. J Mol Biol. 374(5): 1145-57.
  • Jin Q, et al. (2003) The protein phosphatase-1 (PP1) regulator, nuclear inhibitor of PP1 (NIPP1), interacts with the polycomb group protein, embryonic ectoderm development (EED), and functions as a transcriptional repressor. J Biol Chem. 278(33): 30677-85.
  • Showell C, et al. (2002) Identification of putative interaction partners for the Xenopus Polycomb-group protein Xeed. Gene. 291(1-2): 95-104.
  • Rinchik EM, et al. (1993) N-ethyl-N-nitrosourea-induced prenatally lethal mutations define at least two complementation groups within the embryonic ectoderm development (eed) locus in mouse chromosome 7. Mamm Genome. 4(7): 349-53.
  • EED cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    EED cDNA ORF Clone in Cloning Vector, Mouse MG57735-U
    EED cDNA ORF Clone, Mouse, untagged MG57735-UT
    EED cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57735-ACG
    EED Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57735-ACGLN
    EED cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57735-ANG
    EED cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57735-ACR
    EED cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57735-ANR
    EED cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57735-CF
    EED cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57735-NF
    EED cDNA ORF Clone, Mouse, C-His tag MG57735-CH
    EED cDNA ORF Clone, Mouse, N-His tag MG57735-NH
    EED cDNA ORF Clone, Mouse, C-HA tag MG57735-CY
    EED cDNA ORF Clone, Mouse, N-HA tag MG57735-NY
    EED cDNA ORF Clone, Mouse, C-Myc tag MG57735-CM
    EED cDNA ORF Clone, Mouse, N-Myc tag MG57735-NM

    EED cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EED cDNA ORF Clone in Cloning Vector, Human HG11307-M
    EED cDNA ORF Clone, Human, C-GFPSpark® tag HG11307-ACG
    EED Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11307-ACGLN
    EED cDNA ORF Clone, Human, N-GFPSpark® tag HG11307-ANG
    EED cDNA ORF Clone, Human, C-OFPSpark® tag HG11307-ACR
    EED cDNA ORF Clone, Human, N-OFPSpark® tag HG11307-ANR
    EED cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11307-CF
    EED cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11307-NF
    EED cDNA ORF Clone, Human, C-His tag HG11307-CH
    EED cDNA ORF Clone, Human, N-His tag HG11307-NH
    EED cDNA ORF Clone, Human, C-HA tag HG11307-CY
    EED cDNA ORF Clone, Human, N-HA tag HG11307-NY
    EED cDNA ORF Clone, Human, C-Myc tag HG11307-CM
    EED cDNA ORF Clone, Human, N-Myc tag HG11307-NM
    EED qPCR Primer Pairs, Human HP101195
    info info
    添加购物车成功! 添加购物车失败!