After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human EED Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human EED cDNA Clone Product Information
NCBI RefSeq:NM_003797.2
RefSeq ORF Size:1326bp
cDNA Description:Full length Clone DNA of Homo sapiens embryonic ectoderm development.
Gene Synonym:HEED, WAIT1, EED
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-EED
Restriction Site:KpnI + NotI (6.1kb + 1.33kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 619 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human EED Gene Plasmid Map
Human EED Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
References
  • Ura H, et al. (2011) Eed/Sox2 regulatory loop controls ES cell self-renewal through histone methylation and acetylation. EMBO J. 30(11): 2190-204.
  • Montgomery ND, et al. (2007) Molecular and functional mapping of EED motifs required for PRC2-dependent histone methylation. J Mol Biol. 374(5): 1145-57.
  • Jin Q, et al. (2003) The protein phosphatase-1 (PP1) regulator, nuclear inhibitor of PP1 (NIPP1), interacts with the polycomb group protein, embryonic ectoderm development (EED), and functions as a transcriptional repressor. J Biol Chem. 278(33): 30677-85.
  • Showell C, et al. (2002) Identification of putative interaction partners for the Xenopus Polycomb-group protein Xeed. Gene. 291(1-2): 95-104.
  • Rinchik EM, et al. (1993) N-ethyl-N-nitrosourea-induced prenatally lethal mutations define at least two complementation groups within the embryonic ectoderm development (eed) locus in mouse chromosome 7. Mamm Genome. 4(7): 349-53.
  • Size / Price
    Catalog: HG11307-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human EED Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"