Quick Order

Human Endothelin A Receptor Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Human EDNRA cDNA Clone Product Information
    NCBI RefSeq:BC022511
    RefSeq ORF Size:1284bp
    cDNA Description:Full length Clone DNA of Homo sapiens endothelin receptor type A with N terminal Myc tag.
    Gene Synonym:ETA, ET-A, ETAR, ETRA, ETA-R, hET-AR
    Species:Human
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EDNRA qPCR primers for gene expression analysis, HP103107 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    The product of EDNRA, endothelin receptor A, is a G protein-coupled receptor that causes cellular proliferation and contraction (26, 27) of smooth muscle when ligated to endothelin. Polymorphisms in this gene have been associated with variation in vascular phenotypes stemming from vasoconstriction.This gene encodes the receptor for endothelin-1, a peptide that plays a role in potent and long-lasting vasoconstriction. This receptor associates with guanine-nucleotide-binding (G) proteins, and this coupling activates a phosphatidylinositol-calcium second messenger system. Polymorphisms in this gene have been linked to migraine headache resistance. Alternative splicing results in multiple transcript variants.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Darrah R, McKone E, O'Connor C, et al. EDNRA variants associate with smooth muscle mRNA levels, cell proliferation rates, and cystic fibrosis pulmonary disease severity[J]. Physiological genomics, 2010, 41(1): 71-77.
  • Size / Price
    Catalog: HG14459-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"