EDIL3 cDNA ORF Clone, Human, N-His tag

Cat: HG13688-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EDIL3 Reagents
CRO Services
Product recommended

All EDIL3 Reagents
EDIL3 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1467 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human EGF-like repeats and discoidin I-like domains 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Restriction Sites
KpnI + XbaI(6kb+1.47kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
EDIL3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EDIL3 cDNA ORF Clone, Human, N-His tag Validated Images
Rhesus CD3d/CD3 delta Gene Plasmid Map 5615
EDIL3 cDNA ORF Clone, Human, N-His tag Alternative Names
DEL1 cDNA ORF Clone, Human
EDIL3 Background Information
Full Name
EGF-like repeats and discoidin I-like domains 3

EDIL3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EDIL3 cDNA ORF Clone in Cloning Vector, Mouse MG50656-M
EDIL3 cDNA ORF Clone, Mouse, untagged MG50656-UT
EDIL3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50656-ACG
EDIL3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50656-ACGLN
EDIL3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50656-ACR
EDIL3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50656-CF
EDIL3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50656-NF
EDIL3 cDNA ORF Clone, Mouse, C-His tag MG50656-CH
EDIL3 cDNA ORF Clone, Mouse, N-His tag MG50656-NH
EDIL3 cDNA ORF Clone, Mouse, C-HA tag MG50656-CY
EDIL3 cDNA ORF Clone, Mouse, N-HA tag MG50656-NY
EDIL3 cDNA ORF Clone, Mouse, C-Myc tag MG50656-CM
EDIL3 cDNA ORF Clone, Mouse, N-Myc tag MG50656-NM
EDIL3 qPCR Primer Pairs, Mouse MP200635

EDIL3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EDIL3 cDNA ORF Clone in Cloning Vector, Human HG13688-G
EDIL3 cDNA ORF Clone, Human, untagged HG13688-UT
EDIL3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13688-ACGLN
EDIL3 cDNA ORF Clone, Human, C-GFPSpark® tag HG13688-ACG
EDIL3 cDNA ORF Clone, Human, C-OFPSpark® tag HG13688-ACR
EDIL3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13688-CF
EDIL3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13688-NF
EDIL3 cDNA ORF Clone, Human, C-His tag HG13688-CH
EDIL3 cDNA ORF Clone, Human, C-HA tag HG13688-CY
EDIL3 cDNA ORF Clone, Human, N-HA tag HG13688-NY
EDIL3 cDNA ORF Clone, Human, C-Myc tag HG13688-CM
EDIL3 cDNA ORF Clone, Human, N-Myc tag HG13688-NM
EDIL3 qPCR Primer Pairs, Human HP102367
info info
添加购物车成功! 添加购物车失败!