ECSIT cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG14497-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ECSIT Reagents
CRO Services
Product recommended

All ECSIT Reagents
ECSIT cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1296 bp
Description
Full length Clone DNA of Human ECSIT homolog (Drosophila) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ECSIT cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
SITPEC cDNA ORF Clone, Human
ECSIT Background Information

ECSIT is an adapter protein of the toll-like and IL-1 receptor signaling pathway that is involved in the activation of NF-kappa-B via MAP3K1. Activation of NF-kappaB as a consequence of signaling through the Toll and IL-1 receptors is a major element of innate immune responses. ECSIT is specific for the Toll/IL-1 pathways and is a regulator of MEKK-1 processing. It bridges TRAF6 to MEKK-1. Expression of wild-type ECSIT accelerates processing of MEKK-1, whereas a dominant-negative fragment of ECSIT blocks MEKK-1 processing and activation of NF-kappaB. ECSIT is also required for normal embryonic development and efficient assembly of mitochondrial NADH:ubiquinone oxidoreductase.

Full Name
ECSIT signalling integrator
References
  • Kopp E. et al., 1999, Genes Dev. 13 (16): 2059-71.
  • The MGC Project Team. 2004, Genome Res. 14: 2121-7.
  • Vogel RO. et al., 2007, Genes Dev. 21: 615-24.
  • ECSIT cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ECSIT cDNA ORF Clone in Cloning Vector, Mouse MG52140-U
    ECSIT cDNA ORF Clone, Mouse, untagged MG52140-UT
    ECSIT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52140-ACG
    ECSIT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52140-ACGLN
    ECSIT cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52140-ANG
    ECSIT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52140-ACR
    ECSIT cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52140-ANR
    ECSIT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52140-CF
    ECSIT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52140-NF
    ECSIT cDNA ORF Clone, Mouse, C-His tag MG52140-CH
    ECSIT cDNA ORF Clone, Mouse, N-His tag MG52140-NH
    ECSIT cDNA ORF Clone, Mouse, C-HA tag MG52140-CY
    ECSIT cDNA ORF Clone, Mouse, N-HA tag MG52140-NY
    ECSIT cDNA ORF Clone, Mouse, C-Myc tag MG52140-CM
    ECSIT cDNA ORF Clone, Mouse, N-Myc tag MG52140-NM
    ECSIT qPCR Primer Pairs, Mouse MP202013

    ECSIT cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ECSIT cDNA ORF Clone in Cloning Vector, Human HG14497-G
    ECSIT cDNA ORF Clone, Human, untagged HG14497-UT
    ECSIT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14497-ACGLN
    ECSIT cDNA ORF Clone, Human, C-GFPSpark® tag HG14497-ACG
    ECSIT cDNA ORF Clone, Human, N-GFPSpark® tag HG14497-ANG
    ECSIT cDNA ORF Clone, Human, C-OFPSpark® tag HG14497-ACR
    ECSIT cDNA ORF Clone, Human, N-OFPSpark® tag HG14497-ANR
    ECSIT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14497-NF
    ECSIT cDNA ORF Clone, Human, C-His tag HG14497-CH
    ECSIT cDNA ORF Clone, Human, N-His tag HG14497-NH
    ECSIT cDNA ORF Clone, Human, C-HA tag HG14497-CY
    ECSIT cDNA ORF Clone, Human, N-HA tag HG14497-NY
    ECSIT cDNA ORF Clone, Human, C-Myc tag HG14497-CM
    ECSIT cDNA ORF Clone, Human, N-Myc tag HG14497-NM
    ECSIT qPCR Primer Pairs, Human HP103144
    info info
    添加购物车成功! 添加购物车失败!