ECE1 cDNA ORF Clone, Human, N-His tag

Cat: HG10887-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ECE1 Reagents
CRO Services
Product recommended

All ECE1 Reagents
ECE1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2313 bp
Description
Full length Clone DNA of Human endothelin converting enzyme 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ECE1 cDNA ORF Clone, Human, N-His tag Alternative Names
ECE cDNA ORF Clone, Human;RP3-329E20.1 cDNA ORF Clone, Human
ECE1 Background Information

Endothelin-converting enzyme 1, also known as ECE-1, is a single-pass type I I membrane protein which belongs to the peptidase M13 family. ECE-1 converts big endothelin-1 to endothelin-1. ECE-1 is a membrane metalloprotease that generates endothelin from its direct precursor big endothelin. Four isoforms of ECE-1 are produced from a single gene through the use of alternate promoters. These isoforms share the same extracellular catalytic domain and contain unique cytosolic tails, which results in their specific subcellular targeting.All isoforms of ECE-1 are expressed in umbilical vein endothelial cells, polynuclear neutrophils, fibroblasts, atrium cardiomyocytes and ventricles. Isoforms A, B and C of ECE-1 are also expressed in placenta, lung, heart, adrenal gland and phaeochromocytoma; isoforms A and C of ECE-1 in liver, testis and small intestine; isoform B, C and D of ECE-1 in endothelial cells and umbilical vein smooth muscle cells; isoforms C and D in saphenous vein cells, and isoform C in kidney. Defects in ECE1 are a cause of Hirschsprung disease, cardiac defects and autonomic dysfunction. It is a form of Hirschsprung disease with skip-lesions defects, craniofacial abnormalities and other dysmorphic features, and autonomic dysfunction.

Full Name
endothelin converting enzyme 1
References
  • Yorimitsu K., et al.,(1995), Cloning and sequencing of a human endothelin converting enzyme in renal adenocarcinoma (ACHN) cells producing endothelin-2. Biochem. Biophys. Res. Commun. 208:721-727.
  • Shimada K., et al., (1995), Cloning and functional expression of human endothelin-converting enzyme cDNA.Biochem. Biophys. Res. Commun. 207:807-812.
  • Valdenaire O., et al.,(1995), Organization of the gene encoding the human endothelin-converting enzyme (ECE-1).J. Biol. Chem. 270:29794-29798.
  • info info
    添加购物车成功! 添加购物车失败!