After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ECE1/ECE-1 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human ECE1 cDNA Clone Product Information
NCBI RefSeq:NM_001397.2
RefSeq ORF Size:2313bp
cDNA Description:Full length Clone DNA of Homo sapiens endothelin converting enzyme 1 with N terminal Myc tag.
Gene Synonym:ECE, ECE1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Endothelin-converting enzyme 1, also known as ECE-1, is a single-pass type I I membrane protein which belongs to the peptidase M13 family. ECE-1 converts big endothelin-1 to endothelin-1. ECE-1 is a membrane metalloprotease that generates endothelin from its direct precursor big endothelin. Four isoforms of ECE-1 are produced from a single gene through the use of alternate promoters. These isoforms share the same extracellular catalytic domain and contain unique cytosolic tails, which results in their specific subcellular targeting.All isoforms of ECE-1 are expressed in umbilical vein endothelial cells, polynuclear neutrophils, fibroblasts, atrium cardiomyocytes and ventricles. Isoforms A, B and C of ECE-1 are also expressed in placenta, lung, heart, adrenal gland and phaeochromocytoma; isoforms A and C of ECE-1 in liver, testis and small intestine; isoform B, C and D of ECE-1 in endothelial cells and umbilical vein smooth muscle cells; isoforms C and D in saphenous vein cells, and isoform C in kidney. Defects in ECE1 are a cause of Hirschsprung disease, cardiac defects and autonomic dysfunction. It is a form of Hirschsprung disease with skip-lesions defects, craniofacial abnormalities and other dysmorphic features, and autonomic dysfunction.

Size / Price
Catalog: HG10887-NM
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"