Quick Order

Human ECD / Ecdysoneless homolog Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human ECD cDNA Clone Product Information
NCBI RefSeq:BC000721
RefSeq ORF Size:1935bp
cDNA Description:Full length Clone DNA of Homo sapiens ecdysoneless homolog (DrosophilA) with N terminal His tag.
Gene Synonym:GCR2, HSGT1, ECD
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

ECD, also known as ecdysoneless homolog, belongs to the SGT1 family. It is highly expressed in muscle and heart. ECD is a novel promoter of mammalian cell cycle progression. This function is related to its ability to remove the repressive effects of Rb-family tumor suppressors on E2F transcription factors. It is a novel tumor-promoting factor that is differentially expressed in pancreatic cancer and potentially regulates glucose metabolism within cancer cells. ECD may also be a transcriptional activator required for the expression of glycolytic genes.

References
  • Badzek S. et al., 2011, Wien Klin Wochenschr. 123 (23-24): 726-31.
  • Zhao X. et al., 2012, Breast Cancer Res Treat. 134 (1): 171-80.
  • Dey P. et al., 2012, Clin Cancer Res. 18 (22): 6188-98.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"