EBI3 / IL27b cDNA ORF Clone, Human, C-Myc tag

Cat: HG10117-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EBI3 / IL27b Reagents
CRO Services
Product recommended

All EBI3 / IL27b Reagents
EBI3 / IL27b cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
690 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human Epstein-Barr virus induced 3 (EBI3) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
HindIII + XbaI (6kb + 0.74kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
EBI3 / IL27b cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EBI3 / IL27b cDNA ORF Clone, Human, C-Myc tag Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5621
EBI3 / IL27b cDNA ORF Clone, Human, C-Myc tag Alternative Names
IL-27B cDNA ORF Clone, Human;IL27B cDNA ORF Clone, Human
EBI3 / IL27b Background Information
Full Name
Epstein-Barr virus induced 3

EBI3 / IL27b cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EBI3 / IL27b cDNA ORF Clone in Cloning Vector, Rat RG80427-G
EBI3 / IL27b cDNA ORF Clone, Rat, untagged RG80427-UT
EBI3 / IL27b Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80427-ACGLN
EBI3 / IL27b cDNA ORF Clone, Rat, C-GFPSpark® tag RG80427-ACG
EBI3 / IL27b cDNA ORF Clone, Rat, C-OFPSpark® tag RG80427-ACR
EBI3 / IL27b cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80427-CF
EBI3 / IL27b cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80427-NF
EBI3 / IL27b cDNA ORF Clone, Rat, C-His tag RG80427-CH
EBI3 / IL27b cDNA ORF Clone, Rat, N-His tag RG80427-NH
EBI3 / IL27b cDNA ORF Clone, Rat, C-HA tag RG80427-CY
EBI3 / IL27b cDNA ORF Clone, Rat, N-HA tag RG80427-NY
EBI3 / IL27b cDNA ORF Clone, Rat, C-Myc tag RG80427-CM
EBI3 / IL27b cDNA ORF Clone, Rat, N-Myc tag RG80427-NM
EBI3 / IL27b qPCR Primer Pairs, Rat RP300397

EBI3 / IL27b cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EBI3 / IL27b cDNA ORF Clone in Cloning Vector, Mouse MG51058-G
EBI3 / IL27b cDNA ORF Clone, Mouse, untagged MG51058-UT
EBI3 / IL27b Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51058-ACGLN
EBI3 / IL27b cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51058-ACG
EBI3 / IL27b cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51058-ACR
EBI3 / IL27b cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51058-CF
EBI3 / IL27b cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51058-NF
EBI3 / IL27b cDNA ORF Clone, Mouse, C-His tag MG51058-CH
EBI3 / IL27b cDNA ORF Clone, Mouse, N-His tag MG51058-NH
EBI3 / IL27b cDNA ORF Clone, Mouse, C-HA tag MG51058-CY
EBI3 / IL27b cDNA ORF Clone, Mouse, N-HA tag MG51058-NY
EBI3 / IL27b cDNA ORF Clone, Mouse, C-Myc tag MG51058-CM
EBI3 / IL27b cDNA ORF Clone, Mouse, N-Myc tag MG51058-NM
EBI3 / IL27b qPCR Primer Pairs, Mouse MP201016

EBI3 / IL27b cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EBI3 / IL27b cDNA ORF Clone in Cloning Vector, Human HG10117-M
EBI3 / IL27b cDNA ORF Clone, Human, untagged HG10117-UT
EBI3 / IL27b Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10117-ACGLN
EBI3 / IL27b cDNA ORF Clone, Human, C-GFPSpark® tag HG10117-ACG
EBI3 / IL27b cDNA ORF Clone, Human, C-OFPSpark® tag HG10117-ACR
EBI3 / IL27b cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10117-CF
EBI3 / IL27b cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10117-NF
EBI3 / IL27b cDNA ORF Clone, Human, C-His tag HG10117-CH
EBI3 / IL27b cDNA ORF Clone, Human, N-His tag HG10117-NH
EBI3 / IL27b cDNA ORF Clone, Human, C-HA tag HG10117-CY
EBI3 / IL27b cDNA ORF Clone, Human, N-HA tag HG10117-NY
EBI3 / IL27b cDNA ORF Clone, Human, N-Myc tag HG10117-NM
EBI3 / IL27b qPCR Primer Pairs, Human HP100191
info info
添加购物车成功! 添加购物车失败!