After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human DKK1/Dkk-1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human DKK1 cDNA Clone Product Information
NCBI RefSeq:NM_012242.2
RefSeq ORF Size:795bp
cDNA Description:Full length Clone DNA of Homo sapiens dickkopf homolog 1 (Xenopus laevis) with N terminal His tag.
Gene Synonym:SK, DKK-1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Dickkopf (DKK) family proteins, consisting of DKK-1, DKK-2, DKK-3 and DKK-4, function as secreted Wnt antagonists by inhibiting Wnt coreceptors LRP5/6. DKK-1, DKK-2, and DKK-4 also bind cell surface Kremen-1 or Kremen-2 and promote the internalization of LRP5/6. Dickkopf related protein 1 (DKK-1) was initially identified as an inducer of head formation in Xenopus embryos. DKK-1 protein modulates Wnt signaling pathway during embryonic development. Increased levels of DKK-1 are found in the majority of lung cancers, esophageal squamous cell carcinomas, and hormone-resistant breast cancers, while DKK-1 expression is decreased in malignant melanoma and colorectal cancers.

References
  • Horwitz EM. (2004) Dkk-1-mediated expansion of adult stem cells. Trends Biotechnol. 22(8): 386-8.
  • Jiang T, et al. (2009) Clinical significance of serum DKK-1 in patients with gynecological cancer. Int J Gynecol Cancer. 19(7): 1177-81.
  • Size / Price
    Catalog: HG10170-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"