Quick Order

Text Size:AAA

Human DYRK3 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human DYRK3 cDNA Clone Product Information
NCBI RefSeq:NM_003582.2
RefSeq ORF Size:1767bp
cDNA Description:Full length Clone DNA of Homo sapiens dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 with C terminal Myc tag.
Gene Synonym:RED, REDK, DYRK5, hYAK3-2, DYRK3
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Dual specificity tyrosine-phosphorylation-regulated kinase 3, also known as Regulatory erythroid kinase, REDK and DYRK3, is a nucleus protein which belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family and MNB/DYRK subfamily. DYRKs are an emerging family of dual-specificity kinases that play key roles in cell proliferation, survival, and development. DYRK3 contains one protein kinase domain. Isoform 1 and isoform 2 of DYRK3 are highly expressed in testis and in hematopoietic tissue such as fetal liver, and bone marrow. Isoform 2 of DYRK3 is the predominant form in testis. Isoform 1 of DYRK3 is the predominant form in fetal liver and bone marrow. Isoform 1 and isoform 2 are present at low levels in heart, pancreas, lymph node, and thymus. DYRK3 is a negative regulator of EPO-dependent erythropoiesis. It may place an upper limit on red cell production during stress erythropoiesis. DYRK3 inhibits cell death due to cytokine withdrawal in hematopoietic progenitor cells. It may also act by regulating CREB/CRE signaling. DYRK3 proved to effectively inhibit NFAT (nuclear factor of activated T cells) transcriptional response pathways and to co-immunoprecipitate with NFATc3. DYRK3 attenuates (and possibly apportions) red cell production selectively during anemia.

References
  • Becker W., et al., 1998, J. Biol. Chem. 273: 25893-25902.
  • Himpel,S. et al., 2000,J Biol Chem  275 (4):2431-8.
  • Li,K. et al., 2002, J Biol Chem. 277 (49):47052-60.
  • Bogacheva,O. et al., 2008, J Biol Chem. 283 (52):36665-75.
  • Guo,X. et al., 2010, J Biol Chem.285 (17):13223-32.
  • Size / Price
    Catalog: HG10726-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"