Quick Order

Human DYRK2 Gene ORF cDNA clone expression plasmid, N-HA tag

  • Cynomolgus LOC101926731 Gene Plasmid Map 5628
DatasheetReviewsRelated ProductsProtocols
Human DYRK2 cDNA Clone Product Information
NCBI RefSeq:NM_003583.3
RefSeq ORF Size:1629 bp
cDNA Description:Full length Clone DNA of Homo sapiens dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 with N terminal HA tag.
Gene Synonym:FLJ21217, FLJ21365
Species:Human
Vector:pCMV3-N-HA
Plasmid:pCMV3-HA-DYRK2
Restriction Site:KpnI + XbaI(6kb+1.63kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with DYRK2 qPCR primers for gene expression analysis, HP100615 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Size / Price
Catalog: HG10642-NY
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"