Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG15915-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cytoplasmic dynein 1 light intermediate chain 1 Reagents
CRO Services
Product recommended

All Cytoplasmic dynein 1 light intermediate chain 1 Reagents
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1572 bp
Description
Full length Clone DNA of Human dynein, cytoplasmic 1, light intermediate chain 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, C-Myc tag Alternative Names
DNCLI1 cDNA ORF Clone, Human;LIC1 cDNA ORF Clone, Human
Cytoplasmic dynein 1 light intermediate chain 1 Background Information
Full Name
dynein, cytoplasmic 1, light intermediate chain 1

Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone in Cloning Vector, Mouse MG52715-G
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Mouse, untagged MG52715-UT
Cytoplasmic dynein 1 light intermediate chain 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52715-ACGLN
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52715-ACG
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52715-ANG
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52715-ACR
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52715-ANR
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52715-CF
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52715-NF
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Mouse, C-His tag MG52715-CH
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Mouse, N-His tag MG52715-NH
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Mouse, C-HA tag MG52715-CY
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Mouse, N-HA tag MG52715-NY
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Mouse, C-Myc tag MG52715-CM
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Mouse, N-Myc tag MG52715-NM
Cytoplasmic dynein 1 light intermediate chain 1 qPCR Primer Pairs, Mouse MP202586

Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone in Cloning Vector, Human HG15915-G
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, untagged HG15915-UT
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15915-ACG
Cytoplasmic dynein 1 light intermediate chain 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15915-ACGLN
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15915-ANG
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15915-ACR
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15915-ANR
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15915-CF
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15915-NF
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, C-His tag HG15915-CH
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, N-His tag HG15915-NH
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, C-HA tag HG15915-CY
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, N-HA tag HG15915-NY
Cytoplasmic dynein 1 light intermediate chain 1 cDNA ORF Clone, Human, N-Myc tag HG15915-NM
Cytoplasmic dynein 1 light intermediate chain 1 qPCR Primer Pairs, Human HP104504
info info
添加购物车成功! 添加购物车失败!