DTD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15117-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DTD1 Reagents
CRO Services
Product recommended

All DTD1 Reagents
DTD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
630 bp
Description
Full length Clone DNA of Human D-tyrosyl-tRNA deacylase 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DTD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
bA379J5.3 cDNA ORF Clone, Human;bA555E18.1 cDNA ORF Clone, Human;C20orf88 cDNA ORF Clone, Human;DUE-B cDNA ORF Clone, Human;DUEB cDNA ORF Clone, Human;HARS2 cDNA ORF Clone, Human;pqn-68 cDNA ORF Clone, Human
DTD1 Background Information
Full Name
D-tyrosyl-tRNA deacylase 1

DTD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DTD1 cDNA ORF Clone in Cloning Vector, Mouse MG5A7044-U
DTD1 cDNA ORF Clone, Mouse, untagged MG5A7044-UT
DTD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7044-ACGLN
DTD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7044-ACG
DTD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A7044-ANG
DTD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7044-ACR
DTD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A7044-ANR
DTD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7044-CF
DTD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7044-NF
DTD1 cDNA ORF Clone, Mouse, C-His tag MG5A7044-CH
DTD1 cDNA ORF Clone, Mouse, N-His tag MG5A7044-NH
DTD1 cDNA ORF Clone, Mouse, C-HA tag MG5A7044-CY
DTD1 cDNA ORF Clone, Mouse, N-HA tag MG5A7044-NY
DTD1 cDNA ORF Clone, Mouse, C-Myc tag MG5A7044-CM
DTD1 cDNA ORF Clone, Mouse, N-Myc tag MG5A7044-NM

DTD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DTD1 cDNA ORF Clone in Cloning Vector, Human HG15117-G
DTD1 cDNA ORF Clone, Human, untagged HG15117-UT
DTD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15117-ACGLN
DTD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15117-ACG
DTD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15117-ANG
DTD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15117-ACR
DTD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15117-ANR
DTD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15117-NF
DTD1 cDNA ORF Clone, Human, C-His tag HG15117-CH
DTD1 cDNA ORF Clone, Human, N-His tag HG15117-NH
DTD1 cDNA ORF Clone, Human, C-HA tag HG15117-CY
DTD1 cDNA ORF Clone, Human, N-HA tag HG15117-NY
DTD1 cDNA ORF Clone, Human, C-Myc tag HG15117-CM
DTD1 cDNA ORF Clone, Human, N-Myc tag HG15117-NM
DTD1 qPCR Primer Pairs, Human HP103744
info info
添加购物车成功! 添加购物车失败!