DRG1 cDNA ORF Clone, Human, C-HA tag

Cat: HG14741-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DRG1 Reagents
CRO Services
Product recommended

All DRG1 Reagents
DRG1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1104 bp
Description
Full length Clone DNA of Human developmentally regulated GTP binding protein 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DRG1 cDNA ORF Clone, Human, C-HA tag Alternative Names
NEDD3 cDNA ORF Clone, Human
DRG1 Background Information
Full Name
developmentally regulated GTP binding protein 1

DRG1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DRG1 cDNA ORF Clone in Cloning Vector, Mouse MG51446-U
DRG1 cDNA ORF Clone, Mouse, untagged MG51446-UT
DRG1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51446-ACG
DRG1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51446-ACGLN
DRG1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51446-ANG
DRG1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51446-ACR
DRG1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51446-ANR
DRG1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51446-CF
DRG1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51446-NF
DRG1 cDNA ORF Clone, Mouse, C-His tag MG51446-CH
DRG1 cDNA ORF Clone, Mouse, N-His tag MG51446-NH
DRG1 cDNA ORF Clone, Mouse, C-HA tag MG51446-CY
DRG1 cDNA ORF Clone, Mouse, N-HA tag MG51446-NY
DRG1 cDNA ORF Clone, Mouse, C-Myc tag MG51446-CM
DRG1 cDNA ORF Clone, Mouse, N-Myc tag MG51446-NM
DRG1 qPCR Primer Pairs, Mouse MP201330

DRG1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DRG1 cDNA ORF Clone in Cloning Vector, Human HG14741-G
DRG1 cDNA ORF Clone, Human, untagged HG14741-UT
DRG1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14741-ACG
DRG1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14741-ACGLN
DRG1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14741-ANG
DRG1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14741-ACR
DRG1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14741-ANR
DRG1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14741-CF
DRG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14741-NF
DRG1 cDNA ORF Clone, Human, C-His tag HG14741-CH
DRG1 cDNA ORF Clone, Human, N-His tag HG14741-NH
DRG1 cDNA ORF Clone, Human, N-HA tag HG14741-NY
DRG1 cDNA ORF Clone, Human, C-Myc tag HG14741-CM
DRG1 cDNA ORF Clone, Human, N-Myc tag HG14741-NM
DRG1 qPCR Primer Pairs, Human HP103374
info info
添加购物车成功! 添加购物车失败!