DR1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG15029-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DR1 Reagents
CRO Services
Product recommended

All DR1 Reagents
DR1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
531 bp
Description
Full length Clone DNA of Human down-regulator of transcription 1, TBP-binding (negative cofactor 2) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DR1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
NC2 cDNA ORF Clone, Human;NC2-BETA cDNA ORF Clone, Human
DR1 Background Information
Full Name
down-regulator of transcription 1, TBP-binding (negative cofactor 2)

DR1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DR1 cDNA ORF Clone in Cloning Vector, Mouse MG5A2508-U
DR1 cDNA ORF Clone, Mouse, untagged MG5A2508-UT
DR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2508-ACGLN
DR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2508-ACG
DR1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2508-ANG
DR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2508-ACR
DR1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2508-ANR
DR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2508-CF
DR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2508-NF
DR1 cDNA ORF Clone, Mouse, C-His tag MG5A2508-CH
DR1 cDNA ORF Clone, Mouse, N-His tag MG5A2508-NH
DR1 cDNA ORF Clone, Mouse, C-HA tag MG5A2508-CY
DR1 cDNA ORF Clone, Mouse, N-HA tag MG5A2508-NY
DR1 cDNA ORF Clone, Mouse, C-Myc tag MG5A2508-CM
DR1 cDNA ORF Clone, Mouse, N-Myc tag MG5A2508-NM

DR1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DR1 cDNA ORF Clone in Cloning Vector, Human HG15029-G
DR1 cDNA ORF Clone, Human, untagged HG15029-UT
DR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15029-ACGLN
DR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15029-ACG
DR1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15029-ANG
DR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15029-ACR
DR1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15029-ANR
DR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15029-CF
DR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15029-NF
DR1 cDNA ORF Clone, Human, C-His tag HG15029-CH
DR1 cDNA ORF Clone, Human, N-His tag HG15029-NH
DR1 cDNA ORF Clone, Human, C-HA tag HG15029-CY
DR1 cDNA ORF Clone, Human, N-HA tag HG15029-NY
DR1 cDNA ORF Clone, Human, C-Myc tag HG15029-CM
DR1 qPCR Primer Pairs, Human HP103657
info info
添加购物车成功! 添加购物车失败!