DPP3 cDNA ORF Clone, Human, N-Myc tag

Cat: HG11452-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DPP3 Reagents
CRO Services
Product recommended

All DPP3 Reagents
DPP3 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2214 bp
Description
Full length Clone DNA of Human dipeptidyl-peptidase 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DPP3 cDNA ORF Clone, Human, N-Myc tag Alternative Names
DPPIII cDNA ORF Clone, Human
DPP3 Background Information
Full Name
dipeptidyl-peptidase 3

DPP3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DPP3 cDNA ORF Clone in Cloning Vector, Mouse MG53458-U
DPP3 cDNA ORF Clone, Mouse, untagged MG53458-UT
DPP3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53458-ACG
DPP3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53458-ACGLN
DPP3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53458-ANG
DPP3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53458-ACR
DPP3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53458-ANR
DPP3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53458-CF
DPP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53458-NF
DPP3 cDNA ORF Clone, Mouse, C-His tag MG53458-CH
DPP3 cDNA ORF Clone, Mouse, N-His tag MG53458-NH
DPP3 cDNA ORF Clone, Mouse, C-HA tag MG53458-CY
DPP3 cDNA ORF Clone, Mouse, N-HA tag MG53458-NY
DPP3 cDNA ORF Clone, Mouse, C-Myc tag MG53458-CM
DPP3 cDNA ORF Clone, Mouse, N-Myc tag MG53458-NM

DPP3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DPP3 cDNA ORF Clone in Cloning Vector, Human HG11452-M
DPP3 cDNA ORF Clone, Human, untagged HG11452-UT
DPP3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11452-ACGLN
DPP3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11452-ACG
DPP3 cDNA ORF Clone, Human, N-GFPSpark® tag HG11452-ANG
DPP3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11452-ACR
DPP3 cDNA ORF Clone, Human, N-OFPSpark® tag HG11452-ANR
DPP3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11452-CF
DPP3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11452-NF
DPP3 cDNA ORF Clone, Human, C-His tag HG11452-CH
DPP3 cDNA ORF Clone, Human, N-His tag HG11452-NH
DPP3 cDNA ORF Clone, Human, C-HA tag HG11452-CY
DPP3 cDNA ORF Clone, Human, N-HA tag HG11452-NY
DPP3 cDNA ORF Clone, Human, C-Myc tag HG11452-CM
DPP3 qPCR Primer Pairs, Human HP101329
info info
添加购物车成功! 添加购物车失败!