DPM1 cDNA ORF Clone, Human, N-HA tag

Cat: HG14691-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DPM1 Reagents
CRO Services
Product recommended

All DPM1 Reagents
DPM1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
783 bp
Description
Full length Clone DNA of Human dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DPM1 cDNA ORF Clone, Human, N-HA tag Alternative Names
CDGIE cDNA ORF Clone, Human;MPDS cDNA ORF Clone, Human
DPM1 Background Information
Full Name
dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit

DPM1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
DPM1 cDNA ORF Clone in Cloning Vector, Canine DG70206-U
DPM1 cDNA ORF Clone, Canine, untagged DG70206-UT
DPM1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70206-ACG
DPM1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70206-ACGLN
DPM1 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70206-ANG
DPM1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70206-ACR
DPM1 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70206-ANR
DPM1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70206-CF
DPM1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70206-NF
DPM1 cDNA ORF Clone, Canine, C-His tag DG70206-CH
DPM1 cDNA ORF Clone, Canine, N-His tag DG70206-NH
DPM1 cDNA ORF Clone, Canine, C-HA tag DG70206-CY
DPM1 cDNA ORF Clone, Canine, N-HA tag DG70206-NY
DPM1 cDNA ORF Clone, Canine, C-Myc tag DG70206-CM
DPM1 cDNA ORF Clone, Canine, N-Myc tag DG70206-NM

DPM1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DPM1 cDNA ORF Clone in Cloning Vector, Rat RG86725-U
DPM1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86725-ACGLN

DPM1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DPM1 cDNA ORF Clone in Cloning Vector, Human HG14691-G
DPM1 cDNA ORF Clone, Human, untagged HG14691-UT
DPM1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14691-ACGLN
DPM1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14691-ACG
DPM1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14691-ANG
DPM1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14691-ACR
DPM1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14691-ANR
DPM1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14691-CF
DPM1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14691-NF
DPM1 cDNA ORF Clone, Human, C-His tag HG14691-CH
DPM1 cDNA ORF Clone, Human, N-His tag HG14691-NH
DPM1 cDNA ORF Clone, Human, C-HA tag HG14691-CY
DPM1 cDNA ORF Clone, Human, C-Myc tag HG14691-CM
DPM1 cDNA ORF Clone, Human, N-Myc tag HG14691-NM
DPM1 qPCR Primer Pairs, Human HP103325
info info
添加购物车成功! 添加购物车失败!