Quick Order

Human DEPE2 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human DPEP2 cDNA Clone Product Information
NCBI RefSeq:BC024021
RefSeq ORF Size:1200bp
cDNA Description:Full length Clone DNA of Homo sapiens dipeptidase 2 with N terminal His tag.
Gene Synonym:UNQ284/PRO323, MBD2, DPEP2
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

DPEP2 (MBD-2) belongs to the membrane-bound dipeptidase family. There are three members of this family as membrane-bound dipeptidase-1 (MBD-1),membrane-bound dipeptidase-2 (MBD-2) and membrane-bound dipeptidase-3 (MBD-3).MBD-2 is expressed at highest levels in lung, heart, and testis and at some what lower levels in spleen.MBD-2 is membrane-bound through a glycosylphosphatidyl-inositol linkage and probably is a metalloprotease which hydrolyzes leukotriene D4 (LTD4) into leukotriene E4 (LTE4).It is generally recognized that rapid cleavage of LTD4 is important in inactivating the broncho-and vaso-constrictive effects of cysteinyl LTs in asthmatic and inflammatory processes.

References
  • Geetha M. Habib.et al.,2003,The FASEB Journal.8
  • Habib,G.M.,and Lieberman,M.W.1999,Adv.Exp.Med.Biol.469,295-300
  • Campbell, B. Jet al.,1984,J.Biol.Chem.259,14586-14590.
  • Size / Price
    Catalog: HG13806-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"