DPEP1 cDNA ORF Clone, Human, C-His tag

Cat: HG13543-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DPEP1 Reagents
CRO Services
Product recommended

All DPEP1 Reagents
DPEP1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1281 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human dipeptidase 1 (renal) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
HindIII + XbaI(6kb+1.28kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
DPEP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DPEP1 cDNA ORF Clone, Human, C-His tag Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5620
DPEP1 cDNA ORF Clone, Human, C-His tag Alternative Names
MBD1 cDNA ORF Clone, Human;MDP cDNA ORF Clone, Human;RDP cDNA ORF Clone, Human
DPEP1 Background Information

Dehydropeptidase-I, also known as DPEP1, is a kidney membrane enzyme. Its expression in normal colonic mucosa is very low, but it is highly expressed in colorectal adenoma and cancer specimens and is negatively correlated with parameters of pathological aggressiveness and poor prognosis. The overexpression of DPEP1 suppressed tumor cells invasiveness and increased sensitivity to chemotherapeutic agent Gemcitabine. Growth factor EGF treatment decreased DPEP1 expression. Dehydropeptidase-I may be a candidate target in PDAC for designing improved treatments. It uses zinc as a cofactor and acts as a disulfide-linked homodimer.

Full Name
dipeptidase 1 (renal)
References
  • Toiyama Y. et al., 2011, J Gastroenterol. 46 (2): 153-63.
  • Zhang G. et al., 2012, PLoS One. 7 (2): e31507.
  • Okamoto T. et al., 2011, Mod Pathol. 24 (2): 267-76.
  • DPEP1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    DPEP1 cDNA ORF Clone in Cloning Vector, Mouse MG53160-G
    DPEP1 cDNA ORF Clone, Mouse, untagged MG53160-UT
    DPEP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53160-ACG
    DPEP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53160-ACGLN
    DPEP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53160-ACR
    DPEP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53160-CF
    DPEP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53160-NF
    DPEP1 cDNA ORF Clone, Mouse, C-His tag MG53160-CH
    DPEP1 cDNA ORF Clone, Mouse, N-His tag MG53160-NH
    DPEP1 cDNA ORF Clone, Mouse, C-HA tag MG53160-CY
    DPEP1 cDNA ORF Clone, Mouse, N-HA tag MG53160-NY
    DPEP1 cDNA ORF Clone, Mouse, C-Myc tag MG53160-CM
    DPEP1 cDNA ORF Clone, Mouse, N-Myc tag MG53160-NM

    DPEP1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    DPEP1 cDNA ORF Clone in Cloning Vector, Human HG13543-G
    DPEP1 cDNA ORF Clone, Human, untagged HG13543-UT
    DPEP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13543-ACGLN
    DPEP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13543-ACG
    DPEP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13543-ACR
    DPEP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13543-CF
    DPEP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13543-NF
    DPEP1 cDNA ORF Clone, Human, N-His tag HG13543-NH
    DPEP1 cDNA ORF Clone, Human, C-HA tag HG13543-CY
    DPEP1 cDNA ORF Clone, Human, N-HA tag HG13543-NY
    DPEP1 cDNA ORF Clone, Human, C-Myc tag HG13543-CM
    DPEP1 cDNA ORF Clone, Human, N-Myc tag HG13543-NM
    DPEP1 qPCR Primer Pairs, Human HP102229
    info info
    添加购物车成功! 添加购物车失败!