After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human dehydropeptidase-I / DPEP1 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human DPEP1 cDNA Clone Product Information
NCBI RefSeq:BC017023
RefSeq ORF Size:1236bp
cDNA Description:Full length Clone DNA of Homo sapiens dipeptidase 1 (renal) with N terminal HA tag.
Gene Synonym:MDP, RDP, MBD1, DPEP1
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Dehydropeptidase-I, also known as DPEP1, is a kidney membrane enzyme. Its expression in normal colonic mucosa is very low, but it is highly expressed in colorectal adenoma and cancer specimens and is negatively correlated with parameters of pathological aggressiveness and poor prognosis. The overexpression of DPEP1 suppressed tumor cells invasiveness and increased sensitivity to chemotherapeutic agent Gemcitabine. Growth factor EGF treatment decreased DPEP1 expression. Dehydropeptidase-I may be a candidate target in PDAC for designing improved treatments. It uses zinc as a cofactor and acts as a disulfide-linked homodimer.

References
  • Toiyama Y. et al., 2011, J Gastroenterol. 46 (2): 153-63.
  • Zhang G. et al., 2012, PLoS One. 7 (2): e31507.
  • Okamoto T. et al., 2011, Mod Pathol. 24 (2): 267-76.
  • Size / Price
    Catalog: HG13543-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"