After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human DNMT3A Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human DNMT3A cDNA Clone Product Information
NCBI RefSeq:NM_022552.3
RefSeq ORF Size:2739bp
cDNA Description:Full length Clone DNA of Homo sapiens DNA.(cytosine-5-)-methyltransferase 3 alpha.
Gene Synonym:DNMT3A2, M.HsaIIIA, DNMT3A
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-DNMT3A
Restriction Site:HindIII + XbaI (6.1kb + 2.74kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 9 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human DNMT3A Gene Plasmid Map
Human DNMT3A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11320-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human DNMT3A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"