DNase I cDNA ORF Clone, Human, N-Myc tag

Cat: HG13801-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DNase I Reagents
CRO Services
Product recommended

All DNase I Reagents
DNase I cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
849 bp
Description
Full length Clone DNA of Human deoxyribonuclease I with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DNase I cDNA ORF Clone, Human, N-Myc tag Alternative Names
DNL1 cDNA ORF Clone, Human;DRNI cDNA ORF Clone, Human
DNase I Background Information

DNase1, also known as deoxyribonuclease I and DNL1, is a member of the DNase family. DNaseI is a nuclease that cleaves DNA preferentially at phosphodiester linkages adjacent to a pyrimidine nucleotide, yielding 5'-phosphate-terminated polynucleotides with a free hydroxyl group on position 3', on average producing tetranucleotides. DNaseI binds to the cytoskeletal protein actin. It binds actin monomers with very high (sub-nanomolar) affinity and actin polymers with lower affinity. Mutations in DNase1 gene have been associated with systemic lupus erythematosus (SLE), an autoimmune disease. DNase1 is used to treat the one of the symptoms of cystic fibrosis by hydrolyzing the extracellular DNA in sputum and reducing its viscosity.

Full Name
deoxyribonuclease I
References
  • Shak S. et al., 1991, Proc Natl Acad Sci. 87 (23): 9188-92.
  • Yasutomo K. et al., 2001, Nat Genet. 28 (4): 313-4.
  • Hakkim A. et al., 2010, Proc Natl Acad Sci. 107 (21): 9813-8.
  • DNase I cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    DNase I cDNA ORF Clone in Cloning Vector, Rat RG81502-G

    DNase I cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    DNase I cDNA ORF Clone in Cloning Vector, Mouse MG53486-U
    DNase I cDNA ORF Clone, Mouse, untagged MG53486-UT
    DNase I Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53486-ACGLN
    DNase I cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53486-ACG
    DNase I cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53486-ACR
    DNase I cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53486-CF
    DNase I cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53486-NF
    DNase I cDNA ORF Clone, Mouse, C-His tag MG53486-CH
    DNase I cDNA ORF Clone, Mouse, N-His tag MG53486-NH
    DNase I cDNA ORF Clone, Mouse, C-HA tag MG53486-CY
    DNase I cDNA ORF Clone, Mouse, N-HA tag MG53486-NY
    DNase I cDNA ORF Clone, Mouse, C-Myc tag MG53486-CM
    DNase I cDNA ORF Clone, Mouse, N-Myc tag MG53486-NM

    DNase I cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    DNase I cDNA ORF Clone in Cloning Vector, Human HG13801-G
    DNase I cDNA ORF Clone, Human, untagged HG13801-UT
    DNase I Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13801-ACGLN
    DNase I cDNA ORF Clone, Human, C-GFPSpark® tag HG13801-ACG
    DNase I cDNA ORF Clone, Human, C-OFPSpark® tag HG13801-ACR
    DNase I cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13801-CF
    DNase I cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13801-NF
    DNase I cDNA ORF Clone, Human, C-His tag HG13801-CH
    DNase I cDNA ORF Clone, Human, N-His tag HG13801-NH
    DNase I cDNA ORF Clone, Human, C-HA tag HG13801-CY
    DNase I cDNA ORF Clone, Human, N-HA tag HG13801-NY
    DNase I cDNA ORF Clone, Human, C-Myc tag HG13801-CM
    DNase I qPCR Primer Pairs, Human HP102474
    info info
    添加购物车成功! 添加购物车失败!