DNAL4 cDNA ORF Clone, Human, untagged

Cat: HG16294-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DNAL4 Reagents
CRO Services
Product recommended

All DNAL4 Reagents
DNAL4 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
318 bp
Description
Full length Clone DNA of Human dynein, axonemal, light chain 4.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DNAL4 cDNA ORF Clone, Human, untagged Alternative Names
MRMV3 cDNA ORF Clone, Human;PIG27 cDNA ORF Clone, Human
DNAL4 Background Information
Full Name
dynein, axonemal, light chain 4

DNAL4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DNAL4 cDNA ORF Clone in Cloning Vector, Mouse MG53433-U
DNAL4 cDNA ORF Clone, Mouse, untagged MG53433-UT
DNAL4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53433-ACGLN
DNAL4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53433-ACG
DNAL4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53433-ANG
DNAL4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53433-ACR
DNAL4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53433-ANR
DNAL4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53433-CF
DNAL4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53433-NF
DNAL4 cDNA ORF Clone, Mouse, C-His tag MG53433-CH
DNAL4 cDNA ORF Clone, Mouse, N-His tag MG53433-NH
DNAL4 cDNA ORF Clone, Mouse, C-HA tag MG53433-CY
DNAL4 cDNA ORF Clone, Mouse, N-HA tag MG53433-NY
DNAL4 cDNA ORF Clone, Mouse, C-Myc tag MG53433-CM
DNAL4 cDNA ORF Clone, Mouse, N-Myc tag MG53433-NM

DNAL4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DNAL4 cDNA ORF Clone in Cloning Vector, Human HG16294-G
DNAL4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16294-ACGLN
DNAL4 cDNA ORF Clone, Human, C-GFPSpark® tag HG16294-ACG
DNAL4 cDNA ORF Clone, Human, N-GFPSpark® tag HG16294-ANG
DNAL4 cDNA ORF Clone, Human, C-OFPSpark® tag HG16294-ACR
DNAL4 cDNA ORF Clone, Human, N-OFPSpark® tag HG16294-ANR
DNAL4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16294-CF
DNAL4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16294-NF
DNAL4 cDNA ORF Clone, Human, C-His tag HG16294-CH
DNAL4 cDNA ORF Clone, Human, N-His tag HG16294-NH
DNAL4 cDNA ORF Clone, Human, C-HA tag HG16294-CY
DNAL4 cDNA ORF Clone, Human, N-HA tag HG16294-NY
DNAL4 cDNA ORF Clone, Human, C-Myc tag HG16294-CM
DNAL4 cDNA ORF Clone, Human, N-Myc tag HG16294-NM
DNAL4 qPCR Primer Pairs, Human HP105048
info info
添加购物车成功! 添加购物车失败!