DNAJC30 cDNA ORF Clone, Human, N-His tag

Cat: HG13796-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DNAJC30 Reagents
CRO Services
Product recommended

All DNAJC30 Reagents
DNAJC30 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
681 bp
Description
Full length Clone DNA of Human DnaJ (Hsp40) homolog, subfamily C, member 30 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DNAJC30 cDNA ORF Clone, Human, N-His tag Alternative Names
WBSCR18 cDNA ORF Clone, Human
DNAJC30 Background Information

NAJC30 is a member of the DNAJ molecular chaperone homology domain-containing protein family. DNAJC30 gene is deleted in williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. DNAJC30 is expressed in brain, heart, kidney, liver, lung, spleen, stomach and testis. It contains 1 J domain. DNAJC30 is located in the Williams-Beuren syndrome (WBS) critical region. WBS results from a hemizygous deletion of several genes on chromosome 7q11.23, thought to arise as a consequence of unequal crossing over between highly homologous low-copy repeat sequences flanking the deleted region.

Full Name
DnaJ (Hsp40) homolog, subfamily C, member 30
References
  • Hillier L W, et al. (2003) The DNA sequence of human chromosome 7. Nature. 424:157-164.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36:40-5.
  • Merla G, et al. (2002) Identification of additional transcripts in the Williams-Beuren syndrome critical region. Hum Genet. 110:429-38.
  • DNAJC30 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    DNAJC30 cDNA ORF Clone in Cloning Vector, Mouse MG53163-G
    DNAJC30 cDNA ORF Clone, Mouse, untagged MG53163-UT
    DNAJC30 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53163-ACG
    DNAJC30 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53163-ACGLN
    DNAJC30 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53163-ANG
    DNAJC30 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53163-ACR
    DNAJC30 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53163-ANR
    DNAJC30 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53163-CF
    DNAJC30 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53163-NF
    DNAJC30 cDNA ORF Clone, Mouse, C-His tag MG53163-CH
    DNAJC30 cDNA ORF Clone, Mouse, N-His tag MG53163-NH
    DNAJC30 cDNA ORF Clone, Mouse, C-HA tag MG53163-CY
    DNAJC30 cDNA ORF Clone, Mouse, N-HA tag MG53163-NY
    DNAJC30 cDNA ORF Clone, Mouse, C-Myc tag MG53163-CM
    DNAJC30 cDNA ORF Clone, Mouse, N-Myc tag MG53163-NM

    DNAJC30 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    DNAJC30 cDNA ORF Clone in Cloning Vector, Human HG13796-G
    DNAJC30 cDNA ORF Clone, Human, untagged HG13796-UT
    DNAJC30 cDNA ORF Clone, Human, C-GFPSpark® tag HG13796-ACG
    DNAJC30 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13796-ACGLN
    DNAJC30 cDNA ORF Clone, Human, N-GFPSpark® tag HG13796-ANG
    DNAJC30 cDNA ORF Clone, Human, C-OFPSpark® tag HG13796-ACR
    DNAJC30 cDNA ORF Clone, Human, N-OFPSpark® tag HG13796-ANR
    DNAJC30 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13796-CF
    DNAJC30 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13796-NF
    DNAJC30 cDNA ORF Clone, Human, C-His tag HG13796-CH
    DNAJC30 cDNA ORF Clone, Human, C-HA tag HG13796-CY
    DNAJC30 cDNA ORF Clone, Human, N-HA tag HG13796-NY
    DNAJC30 cDNA ORF Clone, Human, C-Myc tag HG13796-CM
    DNAJC30 cDNA ORF Clone, Human, N-Myc tag HG13796-NM
    DNAJC30 qPCR Primer Pairs, Human HP102469
    info info
    添加购物车成功! 添加购物车失败!