After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human DNAJC30 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human DNAJC30 cDNA Clone Product Information
NCBI RefSeq:NM_032317.2
RefSeq ORF Size:681bp
cDNA Description:Full length Clone DNA of Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 30 with N terminal His tag.
Gene Synonym:WBSCR18, DNAJC30
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

NAJC30 is a member of the DNAJ molecular chaperone homology domain-containing protein family. DNAJC30 gene is deleted in williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. DNAJC30 is expressed in brain, heart, kidney, liver, lung, spleen, stomach and testis. It contains 1 J domain. DNAJC30 is located in the Williams-Beuren syndrome (WBS) critical region. WBS results from a hemizygous deletion of several genes on chromosome 7q11.23, thought to arise as a consequence of unequal crossing over between highly homologous low-copy repeat sequences flanking the deleted region.

References
  • Hillier L W, et al. (2003) The DNA sequence of human chromosome 7. Nature. 424:157-164.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36:40-5.
  • Merla G, et al. (2002) Identification of additional transcripts in the Williams-Beuren syndrome critical region. Hum Genet. 110:429-38.
  • Size / Price
    Catalog: HG13796-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"