Hsp40 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11343-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Hsp40 Reagents
CRO Services
Product recommended

All Hsp40 Reagents
Hsp40 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1062 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human DNA.J (Hsp40) homolog, subfamily B, member 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
HindIII + XbaI(6kb+1.06kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Hsp40 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Hsp40 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human 4E-BP1/EIF4EBP1 Gene Plasmid Map 5648
Hsp40 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
Hdj1 cDNA ORF Clone, Human;Hsp40 cDNA ORF Clone, Human;HSPF1 cDNA ORF Clone, Human;RSPH16B cDNA ORF Clone, Human;Sis1 cDNA ORF Clone, Human
Hsp40 Background Information
Full Name
DnaJ (Hsp40) homolog, subfamily B, member 1

Hsp40 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Hsp40 cDNA ORF Clone in Cloning Vector, Mouse MG5A0077-U
Hsp40 cDNA ORF Clone, Mouse, untagged MG5A0077-UT
Hsp40 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0077-ACG
Hsp40 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0077-ACGLN
Hsp40 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0077-ANG
Hsp40 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0077-ACR
Hsp40 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0077-ANR
Hsp40 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0077-CF
Hsp40 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0077-NF
Hsp40 cDNA ORF Clone, Mouse, C-His tag MG5A0077-CH
Hsp40 cDNA ORF Clone, Mouse, N-His tag MG5A0077-NH
Hsp40 cDNA ORF Clone, Mouse, C-HA tag MG5A0077-CY
Hsp40 cDNA ORF Clone, Mouse, N-HA tag MG5A0077-NY
Hsp40 cDNA ORF Clone, Mouse, C-Myc tag MG5A0077-CM
Hsp40 cDNA ORF Clone, Mouse, N-Myc tag MG5A0077-NM

Hsp40 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Hsp40 cDNA ORF Clone in Cloning Vector, Human HG11343-M
Hsp40 cDNA ORF Clone, Human, untagged HG11343-UT
Hsp40 cDNA ORF Clone, Human, C-GFPSpark® tag HG11343-ACG
Hsp40 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11343-ACGLN
Hsp40 cDNA ORF Clone, Human, N-GFPSpark® tag HG11343-ANG
Hsp40 cDNA ORF Clone, Human, C-OFPSpark® tag HG11343-ACR
Hsp40 cDNA ORF Clone, Human, N-OFPSpark® tag HG11343-ANR
Hsp40 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11343-CF
Hsp40 cDNA ORF Clone, Human, C-His tag HG11343-CH
Hsp40 cDNA ORF Clone, Human, N-His tag HG11343-NH
Hsp40 cDNA ORF Clone, Human, C-HA tag HG11343-CY
Hsp40 cDNA ORF Clone, Human, N-HA tag HG11343-NY
Hsp40 cDNA ORF Clone, Human, C-Myc tag HG11343-CM
Hsp40 cDNA ORF Clone, Human, N-Myc tag HG11343-NM
Hsp40 qPCR Primer Pairs, Human HP101228
info info
添加购物车成功! 添加购物车失败!