DLX3 cDNA ORF Clone, Human, untagged

Cat: HG14395-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DLX3 Reagents
CRO Services
Product recommended

All DLX3 Reagents
DLX3 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
864 bp
Description
Full length Clone DNA of Human distal-less homeobox 3.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DLX3 cDNA ORF Clone, Human, untagged Alternative Names
AI4 cDNA ORF Clone, Human;TDO cDNA ORF Clone, Human
DLX3 Background Information
Full Name
distal-less homeobox 3

DLX3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DLX3 cDNA ORF Clone in Cloning Vector, Mouse MG57976-U
DLX3 cDNA ORF Clone, Mouse, untagged MG57976-UT
DLX3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57976-ACGLN
DLX3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57976-ACG
DLX3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57976-ANG
DLX3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57976-ACR
DLX3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57976-ANR
DLX3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57976-CF
DLX3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57976-NF
DLX3 cDNA ORF Clone, Mouse, C-His tag MG57976-CH
DLX3 cDNA ORF Clone, Mouse, N-His tag MG57976-NH
DLX3 cDNA ORF Clone, Mouse, C-HA tag MG57976-CY
DLX3 cDNA ORF Clone, Mouse, N-HA tag MG57976-NY
DLX3 cDNA ORF Clone, Mouse, C-Myc tag MG57976-CM
DLX3 cDNA ORF Clone, Mouse, N-Myc tag MG57976-NM

DLX3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DLX3 cDNA ORF Clone in Cloning Vector, Human HG14395-G
DLX3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14395-ACG
DLX3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14395-ACGLN
DLX3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14395-ANG
DLX3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14395-ACR
DLX3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14395-ANR
DLX3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14395-CF
DLX3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14395-NF
DLX3 cDNA ORF Clone, Human, C-His tag HG14395-CH
DLX3 cDNA ORF Clone, Human, N-His tag HG14395-NH
DLX3 cDNA ORF Clone, Human, C-HA tag HG14395-CY
DLX3 cDNA ORF Clone, Human, N-HA tag HG14395-NY
DLX3 cDNA ORF Clone, Human, C-Myc tag HG14395-CM
DLX3 cDNA ORF Clone, Human, N-Myc tag HG14395-NM
DLX3 qPCR Primer Pairs, Human HP103044
info info
添加购物车成功! 添加购物车失败!