DLST cDNA ORF Clone, Human, N-HA tag

Cat: HG14072-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DLST Reagents
CRO Services
Product recommended

All DLST Reagents
DLST cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1362 bp
Description
Full length Clone DNA of Human dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DLST cDNA ORF Clone, Human, N-HA tag Alternative Names
DLTS cDNA ORF Clone, Human
DLST Background Information
Full Name
dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)

DLST cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DLST cDNA ORF Clone in Cloning Vector, Mouse MG51418-U
DLST cDNA ORF Clone, Mouse, untagged MG51418-UT
DLST cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51418-ACG
DLST Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51418-ACGLN
DLST cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51418-ANG
DLST cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51418-ACR
DLST cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51418-ANR
DLST cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51418-CF
DLST cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51418-NF
DLST cDNA ORF Clone, Mouse, C-His tag MG51418-CH
DLST cDNA ORF Clone, Mouse, N-His tag MG51418-NH
DLST cDNA ORF Clone, Mouse, C-HA tag MG51418-CY
DLST cDNA ORF Clone, Mouse, N-HA tag MG51418-NY
DLST cDNA ORF Clone, Mouse, C-Myc tag MG51418-CM
DLST cDNA ORF Clone, Mouse, N-Myc tag MG51418-NM
DLST qPCR Primer Pairs, Mouse MP201302

DLST cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DLST cDNA ORF Clone in Cloning Vector, Human HG14072-G
DLST cDNA ORF Clone, Human, untagged HG14072-UT
DLST Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14072-ACGLN
DLST cDNA ORF Clone, Human, C-GFPSpark® tag HG14072-ACG
DLST cDNA ORF Clone, Human, N-GFPSpark® tag HG14072-ANG
DLST cDNA ORF Clone, Human, C-OFPSpark® tag HG14072-ACR
DLST cDNA ORF Clone, Human, N-OFPSpark® tag HG14072-ANR
DLST cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14072-CF
DLST cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14072-NF
DLST cDNA ORF Clone, Human, C-His tag HG14072-CH
DLST cDNA ORF Clone, Human, N-His tag HG14072-NH
DLST cDNA ORF Clone, Human, C-HA tag HG14072-CY
DLST cDNA ORF Clone, Human, C-Myc tag HG14072-CM
DLST cDNA ORF Clone, Human, N-Myc tag HG14072-NM
DLST qPCR Primer Pairs, Human HP102727
info info
添加购物车成功! 添加购物车失败!