Quick Order

Human DLL4 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human DLL4 cDNA Clone Product Information
NCBI RefSeq:NM_019074.2
RefSeq ORF Size:2058bp
cDNA Description:Full length Clone DNA of Homo sapiens delta-like 4 (Drosophila) with N terminal His tag.
Gene Synonym:DLL4, hdelta2, MGC126344
Species:Human
Vector:pCMV3-N-His
Plasmid:pCMV3-His-DLL4
Restriction Site:KpnI (two restriction sites) + XbaI (6kb + 0.35kb + 1.72kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human DLL4 Gene Plasmid Map
Human DLL4 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Delta-like protein 4 (DLL4, Delta4), a type I membrane-bound Notch ligand, is one of five known Notch ligands in mammals and interacts predominantly with Notch 1, which has a key role in vascular development. Recent studies yield substantial insights into the role of DLL4 in angiogenesis. DLL4 is induced by vascular endothelial growth factor (VEGF) and acts downstream of VEGF as a 'brake' on VEGF-induced vessel growth, forming an autoregulatory negative feedback loop inactivating VEGF. DLL4 is downstream of VEGF signaling and its activation triggers a negative feedback that restrains the effects of VEGF. Attenuation of DLL4/Notch signaling results in chaotic vascular network with excessive branching and sprouting. DLL4 is widely distributed in tissues other than vessels including many malignancies. Furthermore, the molecule is internalized on binding its receptor and often transported to the nucleus. In pathological conditions, such as cancer, DLL4 is up-regulated strongly in the tumour vasculature. Blockade of DLL4-mediated Notch signaling strikingly increases nonproductive angiogenesis, but significantly inhibits tumor growth in preclinical mouse models. In preclinical studies, blocking of DLL4/Notch signaling is associated with a paradoxical increase in tumor vessel density, yet causes marked growth inhibition due to functionally defective vasculature. Thus, DLL4 blockade holds promise as an additional strategy for angiogenesis-based cancer therapy.

References
  • Yan M, et al. (2007) Delta-like 4/Notch signaling and its therapeutic implications. Clin Cancer Res. 13(24): 7243-6.
  • Sainson RC, et al. (2007) Anti-Dll4 therapy: can we block tumour growth by increasing angiogenesis? Trends Mol Med. 13(9): 389-95.
  • Martinez JC, et al. (2009) Nuclear and membrane expression of the angiogenesis regulator delta-like ligand 4 (DLL4) in normal and malignant human tissues. Histopathology. 54(5): 598-606.
  • Li JL, et al. (2010) Targeting DLL4 in tumors shows preclinical activity but potentially significant toxicity. Future Oncol. 6(7): 1099-103.
  • Size / Price
    Catalog: HG10171-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"