DKK2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11262-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DKK2 Reagents
CRO Services
Product recommended

All DKK2 Reagents
DKK2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
768 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human dickkopf homolog 2 (Xenopus laevis) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.77kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
DKK2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DKK2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
DKK2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
DKK-2 cDNA ORF Clone, Human
DKK2 Background Information
Full Name
dickkopf WNT signaling pathway inhibitor 2

DKK2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DKK2 cDNA ORF Clone in Cloning Vector, Mouse MG50523-M
DKK2 cDNA ORF Clone, Mouse, untagged MG50523-UT
DKK2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50523-ACGLN
DKK2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50523-ACG
DKK2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50523-ACR
DKK2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50523-CF
DKK2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50523-NF
DKK2 cDNA ORF Clone, Mouse, C-His tag MG50523-CH
DKK2 cDNA ORF Clone, Mouse, N-His tag MG50523-NH
DKK2 cDNA ORF Clone, Mouse, C-HA tag MG50523-CY
DKK2 cDNA ORF Clone, Mouse, N-HA tag MG50523-NY
DKK2 cDNA ORF Clone, Mouse, C-Myc tag MG50523-CM
DKK2 cDNA ORF Clone, Mouse, N-Myc tag MG50523-NM
DKK2 qPCR Primer Pairs, Mouse MP200515

DKK2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DKK2 cDNA ORF Clone in Cloning Vector, Human HG11262-M
DKK2 cDNA ORF Clone, Human, untagged HG11262-UT
DKK2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11262-ACGLN
DKK2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11262-ACG
DKK2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11262-ACR
DKK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11262-CF
DKK2 cDNA ORF Clone, Human, C-His tag HG11262-CH
DKK2 cDNA ORF Clone, Human, N-His tag HG11262-NH
DKK2 cDNA ORF Clone, Human, C-HA tag HG11262-CY
DKK2 cDNA ORF Clone, Human, N-HA tag HG11262-NY
DKK2 cDNA ORF Clone, Human, C-Myc tag HG11262-CM
DKK2 cDNA ORF Clone, Human, N-Myc tag HG11262-NM
DKK2 qPCR Primer Pairs, Human HP101146
info info
添加购物车成功! 添加购物车失败!